Description :
From Genome Similarity Track
Location :
Scaffold_12:133274- 136796
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_04618aminophospholipid translocase putative

Sequence
3522 bases(100 bases per row)
GGAGCTCTACCGACGCGTGAAGACGCCGGGATCGGGCGCCGTCGCAGTGGACGGCGACGTCCGGCGCGTCTTCCTCAACGACAACGACCAAAACAAGGCG
CTGTACGCCACGTGCACCAACGTCGTCGTGACGTCCAAGTACACCATCTTCTCGTTCTTGCCCAAGTTCCTCTTCGAGAGCTTTTGCAAGGTTGCCAACC
TCTTCTTCCTCGTCGTCTCGATCCTGCAGACGATCAAGCCGATCTCCAACACGTACGGCCTGCCCACTAACGCGCCGACGCTCTTCTTCGTCATCTGCAT
TGACGCTGTCTTTGCCATCATGGAAGATCGCCGCCGCCATGCCTCGGACTTCGCAGCCAACTCGGCCACCTGCCATGTACTTGTCGATAACGTCATCGTC
GATCGCCTGTGGTCGCAAGTGCAGGTACGACGCTGCCTCGACGCAAGATCGTATATAGAGACCTGTATAGGTGGGTGATGTCTTGGAGATTCGCAACCGC
GAGGTCATTCCTGCTGACGTGCTGATTCTCTCCGTGGCCGAGCCCGACCCCGCCGTGCCGAGTGGTATTTGCTACGTGGAGACCAAGTCGCTGGATGGGG
AGACGAACCTCAAGCTGCGCCAGGCGCTGCCAGCGACGATGGCCATCATGCGCGAGGCGCAAGACCTCGACAAGCTCAAGGGCAGTATATGCTGCGAGAC
GCCCAACCCGTTCATCAACAAGTTTGCGGGTAACATTGACGTGTGGGTGGCTGGCCAGACGTTCCCGAACGAGCCTCTCAGCATCAAGAACGTGTTACTT
CGTGGTTGCACGCTCCGCAATACGGACTGGGTCTACGGCGTCGTGCTCAACACGGGTAGCGACACCAAGATCATGCAGAGCGCGTCGTCGCCGCCCAACA
AGTGGAGCGATGTCATGCTGACGCTGAACAAGATGATCGGCATCCTCTGTATCGGGCTCATCGTTCTGTGCGCGATCGCGGCGACGGTCTTTGTGACGTG
GCAGAACGAAATCGCGAAGGAAGCGTGGTATCTCCACGGAACCGCCACTGTCGACAAAGTCGTGCTCGTGACGACCGGCGATGTGGTCACAGCGTGGTTT
ACGATGCTCTTCTACTACTTTCTCCTGCTCTACCAAGTCATTCCGATCTCACTGTACGTGTCGCTCACGACAGTCAAGTTTCTCCAGTCGAGCTTCATGG
CCTGGGACATTGAAATGTACCACGCCGAGACGGACACGCCGGCCATTGTGCGCACGATGGCACTTAACGAAGAGCTCGGCCAGATCTCGTACATCTTCTC
GGACAAGACGGGCACGCTCACGTGCAACGTCATGGACTTTCGCAAGTGCTCTATCAACGGCGTCTCGTACGGCTCTGGTCTTACCGAGATCGGTACGTTG
TACACCTTTATCGCTCAAGTTTCACGATGCAAACTTAGGTCGGGCGGCGCTCAAGCGAGCGGGCAAGCCAATTCCACCCGAGCCAAAGATGGAGCCGGGT
GTCAAGCAGATCCCTTACGTCAACTTCGTCGACCCAAAGCTCACCGAGGCGATGCAAGGCAAGCACGGGGCCGAGCAAGAGGTGCCTCAATGTCTCCTCG
ATTGCTCTGTTCACCTACTTGTATAGGAGCGTACGCATCGTTTCTTCGAGCATCTTGCCGTGTGCCACACGGTGATTCCCGAGAAGCTGGACAATGGCGA
AGTGCGTCTCTCGGCGTCATCGCCCGATGAGCAGGCGCTGGTAGCGGGTGCTCAGTTTATGGGGTACGATGCTATGGTCGAGCATAACCACTCTGAAATC
CAATGTATAGCTACAAATTCGAGTCGCGCGCGGTCGGGAAGGCCATCTTGGACGTTGGCGGAGAAAAGAAGACGTACGATGTGCTCGAAGTGCTCGAGTT
CAACTCGACGCGGAAGCGCATGTCGGTCGTGACGCGCCTGCCGACGGGCGAGCTCTACTTGTACACAAAGGGCGCCGACATGATGATCTACCAGCGCCTC
TCGGCCGCGTCCAAAGCGCTCGAGGCGATCACGTCGCAACATATGGAAACGTACGCTGACGACGGTCTTCGCACCCTCGCTATTGCCATGAAGCGACTCG
ACGAAGCCTTCTTTGTGGACTGGGCAGCCAGATTTCGATCCGTGTCTGGCTCAATCCCGGAGCTCGAGAAGCGCAAAAACGGTGCGCAATACGGTAAATA
CCATTTCATCTAAATCCTCGAAACTTAGGCGAGCCCAACGCAATTGATGACCTCATGGAAGAGATGGAGTCCAACCTGGACCTCATTGGGGCGACGGCCA
TCGAGGACAAGCTCCAGAACGGTGTGCCTGACTGCCTCTCGGCGCTAAGTGCGGCCAAGATCAAAGTCTGGATGCTCACCGGCGACAAAGAGGAAACGGC
CATCAACATTGGCTACGGTATGCCAATCGTACCGTGAGTAAAATTGCTCACGTGATGTTGTGTAGCCTGCGCTCTTTTGGACAACTCGATCCACCAAGTC
ATCATCAACATGGAGAACTGCTCGACGCCAGACTTGATTCGTCAAGCTCTCAAGCTGGCAGCCGAGGACTACGCTGCGAAGAACGGAAAGAAGACTTTGC
GCTCGTCATTGACGGAGTAAGTATATACTCCTGCACTGCACGTTTCAACATTGGTACATTTGTCGCAGGAGGCCCTCGAGATTGCACTCAAGCCGCACAT
GAAGATGGATCTTCTGGGGCTCGCCCAGTTTTGCGTCGCAGTCATTTGCTGCCGCGTGTCGCCGGCGCAGAAGGCGGACATGGTGCGCCTCATCCGCGAA
AACATCCCCGAAGCTCGGTACGGGAGCCTGCATTGAATCATATCTTATGCAGTGGGTTGACACAGAACGCTGGCCATCGGTGACGGTGCCAACGACGTGG
CGATGATACAAGCTGCCCACGTGGGAATTGGTATTTCGGGCCAAGAGGGCATGCAGGCGGTCAACTCGAGCGACTATGCCATCGCGCAGTTCCGGTTTCT
GAAGCGATTGCTGCTGGTGCATGGTCGGTGGAACTACCTGCGCATTTCCAAGGTCGTCGTGTACATGTTTTACAAGAACATCACGCTCGTGCTCGCTCAG
TACTGGTAAGTCCATTTGCAAACGTCATGGATTGGCTCCTAGTGGACCCTAGGTATGGGTTTCTCAGCGGCGCGTCGGGCTCCAAGGTCTACTGGGAAAT
CGGCGTTCAAGTCTACAACATTTTCTTCACGGGTCTTCCCATCGTCGTCCTGGGCGTCCTGGACCAGGACCTACCCGATCACATGAGCCTCAAGTACCCT
GCGCTTTACGGCGTGGGGCCGCAGCGCCAACTCTTCAACTACTACACGTTCTTCCGGTGGCTTTGCGCGGCCTTGTACGAGTCGATGGTGATTTTCCTCG
TCATGGTCTACGGCTACAACCCAAGACACAGCTCTGTTGGCAGCGAAGCGCGCGTCGAGTACGGCATCGTGGCCTTCACACTGGCCGTGCTCATCGTCAA
CCTCAAGGTGCGTGTGTTCCGG