Description :
From Genome Similarity Track
Location :
Scaffold_29:1332507- 1334536
Sequence
2029 bases(100 bases per row)
CGATGCTTTAAGAGAAACAAAGGCAACGGGACAGTGACAGTGCCAGTGCGACTGGTCGACGGGAAGGTCGTCACTGTCCCCAACATCAAAATGGATCTGG
CCGTCAAGTTCGAAGACTTCGACAGCCCAGAACAGTTTACTGTTCTCGACGTGGATTCCTACGATTTGATGATCTCTGCGATTTGATGAAGCACGAGTCC
TGGATCGACTGGCGAGGCAAGGCAATTGATGCCATCCGCCCTGCAAAGTCCGACAGAGCATTGGTGAATCATGCTCCTACCTCTGTCAGGACCTGGGGCG
CCCGCAAGGACTGCCATGGTACTGAAGCATCCGGCGGATGCTTGGGAGTCGTCAACTTATATGACGACTTCGAGGAAGCTTCGATGGTGGCAGCGCTAAG
AGGCGCTGACCAAGTGGGTAGCTTAGGTCCACAAGCGGGTAACATAGTCCCGCAGACAGCTGCAGCTGTCACGAACGCTGGTAATATCGTGCCAAAGGTG
GGTAACACCGTGCCACACGCGGTTGCCCAGACCTTAACTGAAGAGGAAGACGTTGGAAACGCTTCCTGTGTGGGTAGCACAGTGCCACACGAGGCCTCGG
GTGCCTCGGATGTCGACGTCACGACATCCCCAGACGTGAGTAACCAAGTTCCACTTCGCGGTCGCCGTCGACAACGACGACAACGCGGCCGGTGGAAGAG
TGTTATCACATCTTCGATGGCGAGACCAGTTTACCCGTCAAGGATTCTGGTGTCCACTTGGAGCCGTTGCCAGAGGTAAAAGAGATACTAACCTCGAGGA
AATGATGCCTGAGTCTTTCCTGACCAGCCTCAAGGCTGGGGTGATTGCCAAGATGGTGCTCATATGACCAGAGGCCACTTAAGAGAAGCTAAACTCCTCC
TTTGCCTTGGACGAGGACGTCCTAGAAGAGTTGAGCAAGCAGCGTCAGATGCGTTTGGGTTCTGAGATCCTTAAGAACCCCATTGATCCGGTGTATCGTT
TGGCGATGGAGTATGTGGACGTGTTGAACAAGCACCCACCGACCCAGCTCCCACCGGATCGAGGCGTACAGCATGAGATCAATCTCGTGCCTGGCACAAA
GTACAGTGTTACGAGACAATGCACTCTTCCACGCGAACAGTACGAGGTCATTGATGCCTTCTTCCCTGCGAAAGCGAAAGCAGGCATGGTGCGGAAGTCA
AAGTTCCCGACTCGGCGCCAACTTTCTGCGTTTGGAAGCCAAACGGGAAGTGGCGTCTAGTAACGCTTATAACAAGCTGAACAGCGCGACGGTGCCGGCC
CAGACACCAATCCCACGTAAGGATGTGTTGCTGAACAACATGACCGGATACGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAGATCCTGA
TGCGCAAGAGCAACATCCCGCTCACCGCGGTGAGCACTCCAAGCTGCATGCTTTGGGAGTGGCTCGTCATGCCACAGGGCTTGTCTAAAGCCCCGGCAGC
ATTCAAGCGCCTGGTGATGCAACTGTTCGGGCCATTGCGTGCCTTCGTACAAACGTACTTCGACGACATCTTCGTCCATATCCGTACCGATGAGGCAATA
CGGCCATGGAGGTGTATTTGGGGCACCTCCGTCGAGTGTTAGACGTGATGCGAGCGAACAAGCGCTACGCCAACATCGACAAGTGCGTCTTCACGTCATC
AGAGATCAAGTTTCTTGGTTGCTTCGTCAGCAGCGTGGCATTCGAGCTGACCCAGACAAGGTTAAGGCCATTGCAGCATGACCGACGCCCCAATTCCAGA
GGAATCCTCGAAAATGACTGGTCTTGGTCAATCACACAGCGCATGGTACGCGGGACTCGCTAAGCCCCTGTCGGGCCTCCTTCAGAAGGACGCCGACTGG
TGCTGGGAGCGAGAGCTCCAGGAAGCCTTTGACGGCATCAAGCCCAGTCTCCAAGAGTATCATGTCCTAGCTCTGCCGGCCGTTCAGCGTCGTCTGCGAT
GCCTCCGACTATGCAATCGGTTGTGCATT