Description :
From Genome Similarity Track
Location :
Scaffold_5:1332432- 1347622
Transcript NameFunction/comments
Physo_348159DnaJ subfamily C member 2 protein
Physo_508787aldose 1-epimerase, putative
Physo_393812ankyrin repeat-containing protein, conserved
Physo_334804PREDICTED: lysosomal thioesterase PPT2 isoform 1
Physo_50903312-oxophytodienoate reductase, putative
Physo_393555ankyrin repeat-containing protein, conserved
Physo_547613callose synthase, putative

Sequence
15190 bases(100 bases per row)
TTTCTTGTCTTTTGATTGGTCAAAATAGTTTAGTTCACAACGTGACAACTGGAGAATTACCCCATCTCCTTCTCCAGCTCTGGGAGCTGGGGAAGGAGAA
AGTAGCTAGAGATTGAGGCAGTTCAGCCGCACACACAATGAACGAAGAGGAAGCTGTACTGGTTGCTACATGCTCAGCTGTCGCACAGGTTGCAGTCCTC
CTATCAGGAGAATCCGACGATGCGCCGCAAGGCCCTAAGGAACAGATTCGTACCGTGACCTCACTGCACTTTGAGCCCATGCTACAGTCAGCCGCGTATG
CAAGTTGGTTTGAAGACAATCTTCGCTGCACCAAGCCAACTTTCCTACGTATTGCTGGTTTACTACGAGATCAAGGTGTTCTGTTTGCTGCTGCCAAAGT
ACGGCAGCATAGCTTTGAGAAGAAAGTTGCAGCCGTGTCAAAACGAGCCCGCAGCAGGGCATCAGCTGCTGCAGTCGTCCACGCAAAGGAGGGTTGCTTC
GTAGCGATAGACGTTTCACCAGTATTGGCCTTCTTCTTCTGATTCCCAACGCGGCGATGTGAGTCTTGGTTGCGGGCTGACGCAGCTACAACTCCGAGCG
CAAAAAGCTGGCTGGGTGTCTCTGAATGCGGCAGCGCCAGCGAGGAAGTGCGGGCATCCAGCTCCGTTTGAGTAGTGGCCGGTGTCGCCTACACAGTCTG
GGCAAGAGCAACATCAGAGGCAGGTATGTCCAAACTGGCAGCAGCCAGCACGAGGTCGCCACTGGCTGACGGGAACGGAGGCGCAGCTCTCGGAGCGTCA
TCGGCAGCTTGCTCCATCTTGCCACGCGTCCGGTGTCTCGGGCACAGTGTTCCCGGCCGACGAAGAACAGCAAAGAAAGGAGAAGGAGAGCGAGTCGCAC
TGTGATTGGCTAATTTTACCTAGATGCGCTCTGTTGTAGCGAACACGCTCTTATACCGGCCCGTGGTTGATAATATTCTATCTGATAGTTTAGGACAGTT
TTGGATTTTGAACGGAATTTTGGACGTTTTACAGAAGTCTTTGGGACCGTTCAGAACTTTTTCAAACCATCCCTACCCCTACAGATTTGCTGATGGTATC
TCCACGTGTGCGCTTACGCTTTGTCACCATCCAAGAACGAAACCAGGCACGCTCTGCCTCTTATTAAAACGCCGCTGTCCGGCTCGGTTCATGCAGCTCT
CATTCTTCAATTAATCTCCTACGGAGCAAGCTCGACACCCTCGCCGTCTCGCCCACTCCACCATGGTGTTCCCCATCTTCAAGACCGTCGCCCTGGTGTC
GTCGCTCCTGGCCGCCGTCGGCGTTGCCAACGCCGAGCTCGAGACCGTCAAGCTCACGCACCCGTACGGCTCCAGCGCGGAGGTCTACCACTTCGGCGCC
CACGTCAAGTCGTTCCACCCCGCTATGGACCCCAAGATGGACTTGCTGTTCATGTCGAAGGAGTCGTTCCTCGACGGCGTGAACCCCATCCGTGGCGGCA
TCCCTGTCGTGTTCCCCAACTTCGGCAGCGCCAAGGGCTTCCCGAGCCACGGCTTCGCCCGCATCACCAACTGGACGCTGGCCAGCCACGTCGACGCGAA
GGACAAGAACAGCCCGAGTGTGGCCAAGTTCACCATGGCTGCCAGCGACTCGACTCGCAAGATGTGGCCCGTCGAGTTCGAGCTTGAGTACGAGGTGAAG
CTGCTCGGCAACCAGCTCGAGACTGCTCTGCGCGTGCGCAACACGAACAAGGACCCGATTGAGTTCCACGCTCTGCTGCACAACTACCTGTGGGTGGACG
ACGCCACCAACAAGGGCGTGCAGGTGTTGGGCCTGAAGGGCGTCGACTACTACGACAAGGTCGCCAAGGTCAACGCCACGGAGACGCGCGCGTACATCGA
CTTCGCTAACCAGACGGACAACGTGTACAGCAACGCCCCCAACACGCTGCACGCTGTGATCAAGGGTGTCAACGCTGTGGACCGCACGGTGACGATCGAC
AAGGCCGCCTTCATCACTGCGAACGGCAAGAAGGTCGAGACCAAGACCGACGCCGTGGTCTGGAACCCGTGGGCTGAACGTGCCAAGGCCATGGAGGACT
TTGGTGACGAGGAGTACAAGAACATGGTCGCCGTCGAGCCCGGCCGCGTGAGCGTCAAGCAGGCCCTCCCCGCTGGCCAGACGTACACGCTGCAGGAGAC
CATCTCGGTCACCACTCTGTAATCTGAAGTACTACGGAGTAGATGTGATGGAAAAATGTAGACGGAAATCGTTGTGCGGCTGGCACTCCCACTCCCGCCT
ACAATACGAATCGAAAGAGTAAAACTCAATTGCATGAAAACCCCTCTCCTCTTCCTCCTAGTCAAGGTTTAACTTTGCGACGTAGTAGTAGGATACCCTA
CGGGATTTCGATGAAAGATAAGGTCGCGGCTGGTACGCCGGCCATTTCAGACACTATTTACAATGAGGTTGAAAGAAAGATTGGTGGTGCTAGGGATGCA
AGACACAAGATACGATAAAATACAACTGCGGTACCTTCGGTTTGCAAGTATTCGATGAACGAACACCACTGCATCTTACAGACGCGAGAGGAGCGCGAAA
GTCCAGACGAAAACCTGTGCCCATGTAGACAAAGGACTCCTCTTTCTTTCGTGCATTCACTATATCCGTGGGCAAGCGCACTTGGCCAGTGTCGAGGAGG
GTTGGCAGAATTCCTCCTTGTTGCCGACTGTACGAGTCAGACTCGTAAACTCACTGTGGATACAGCACGTACAGTACAATACTAACGTACTTCGAAGTAT
AAGGTATTAGAGTCCCCTGCGAATAGAGCGCCCTATGATGAGGGCATACTATAACAATAGACAAATAGCCATTTACTAGAGCGCCGTTCCGAATAGACTG
CTGACAGAATGTACATACACGTTGATATTATACATGTTGAATGCGTTGGGTAACTACTTACCGCGCTCAACTGCGATGCCATTCTGGCATGCTGCCGCAA
GACGACATCGTGCCAGTTTTATTTTTTTTTCAGGAACACAGACAATCAATCATACGACTCGACATCAAAATGCAATCTTATGAGTGGATTGCCAGCGCAA
AACTGGTTAATAATCGTAAGTGTAGAGTAGTAGGAGAACCTGCGCCCCAATTGCATGACCGAATTCGATGGGTTTGCGTTTCGGCCACCTTGTTTCGACA
GTGGTGCAGCAGCCGTGACCACGTCGTGTGGGTGGCTGTCAGCTTTTACGGGGTGACTGTGAGGATCTGGTCGTGAATGAATCGTATCCTAAAGTAGAAG
ATTGCACATGAAAGTGAGAAAATAATAGCCCGCCTAAATTACTTATCAGCTTTTTCGATACGCGCGCGGCACATCAGCAAGTATAAGATGTATGTTGCAT
TCACCCCCGTATGCGTGTACCGAATAGGAGCTCGTCGAGACCACAACAGTGCTTTCAACTTGCTTTTGACGAGGTTTGGATCAAAGAATAGGTGCTCTGC
TAGAAGTACATGAAACATGCAACCACAACATGTTTTGACAACATACTATCTTCATAGCAGTAGCCATATCGAATAGAGTACCCTAACAAATAGTATGCCA
TCAAATACAATGCCCTACTCGGCTCCAGAGGGCACTCTACAAGAATAGTACGCCGCATACTAATTTAGTGTGGGGTGTTTTGCTGTTAGTAGAATTTACT
ACAGTAGACACTAACTCACTGTTAGCTGTATGTTTGCTGACTGTCAGGGGAATAGTTGTTCGATATATTGCGGTTAAAGTTGAGGTAAAGTGAACATGCT
TGGCCAATCTCTTCTTTTACATTCTATGCTAAAAAGTGCAGCTAAGCAGTAAAAGCTATTCAAATATCGAAGTTCTGATTAATATCCGCTCGTCTTGCTC
GAAAATTGCAATTCCATGTTAGCAAAATTTACTAGACACTAACTAACTGTTATTATAATGACACGTACAGCTAACTCTACTGTTAGTGTATAGGGAGAAC
ACTATACAATCCCCCAAGTTGAGTTCCGCCATCTCCTATATATAAAAAAATCGAAGTCAACAAAATAGGCTTGGGCCAAAATATGCTCCACTGGGTTTGA
GCATTGGAAAATCTGCTGGCAATTGGTCAGGAAGATGCCTGTCCAGTGCGTCTGATCGGCGCTCAATCAACAACTCGACGGAGCTGCCCAGCAGCCGGAT
AACCTCGGAAATCGCCTCAAGCTCGAGGTTCGTTTGCTTCAACGTGCGCGGTGCCAATATCTCAGACACTCCGCATGAACTCCTTTGTCTAACAGCAAAT
AAAGTACCCTATCCGGCTCCAGACTTCGAAAGATCTCCGCTATTACCGCTAATATTAAGCAGTGTGGCGTCGTAGGACACCGCCGATGGACAACCTCTCA
CCTTCCCATGCTACATGTACACAGTCACACCCTTGCTCGCTTGTGTCGGTCCTAGCTCCCGGTTGAGCGTGTGTGTGAATATCCTCCTCCACGGCAACAG
TGAAACCGATGCATGGTCGCTGAAATCCTTTGCTATCCGCATGAATGATCCCATCAACGCCAGTAAAGTGCCATGCAGTGAGGGTGCGCCCCTCTTCACT
TTCTCATCACTCTCCAATTCGCGACTCAAGCACCAGCCTACCAGTAGTACCCACCACCACCCGTCCAGCGTCCATGGTCAAGCTCACGGTCACCATCGCC
GCGGCGGTGGGTGCGGCTGCAGTTATCGTCGAAGGGTCCTCCGACCCGGGATCTCCGCTCAGCCCTCACTCGCAATTTTTGCGCGACGGGAGATCGACCA
GTAGTGGCACGGGACTTGGTCCTTCAGACAGCGACGCCGACGAACCTCCCCCGAACGATTTTAGCCGCGACTTGGAGCAACCCGAGCGTGGCGGCATGTT
TCGCGGTGGGCAGCACCATCGCTCGCCCCCGGTTGCAGGAGGTGCCGACTTTTCTCTCAATGCGAGCGACGAAGGAGGTAGACCATGGCACGGTAGCAGA
AGTTTTGATGGTCGTTTCGACAATCCTCCACCGCATGCCGGGGACGGTGAAATGCCACCCTTTTCGAACCATGGGCCATTTCGTAAGGGCCACCCGAAGC
AATTTGGCGACAAGAAACTCGGCAATCGCAATCCTCCTCCTCCACCTTCTGCTGACGGCAAAAGCACTCGTGATCATTTCGCCAACAACCACCCGGGCAT
GGAGATTCGGGCGATCCCTTTGCTGCGGACAGGGGAAAAGGTGGAGTGCCATCTCAGCAGTGGGTTTGGTTCATGGCCTGGTAGTGGAAGTGATGCCGGA
GAAGCTCCACCACCGTCAGACGTAGGCGACGATCTTGCCCCTCCGTTCCCCTGGCAGGATGGTGCTCCCCTCAACTTCCCGACGCCTCCTAGGCAGGGCA
GTGGCGAGGCTTCAAAGCTCCACACTCCTAAAGGAAAGCAGCCTCCATTCCCTCCCCCCCCCCAAGGGTGTCATGCGTGGTGGGGACGGCAAATTTCCGG
GCCACTTGCGCCCAAGCCGTGATGGTTTCCGTCCTCCTCCCCCAACTATGGGCAGTAAGGAAAAACCTATCGCCACCAACCACGAGTACGACCCCGACGG
AGAAGATACCAACAAGTCTGGTGAACGCAACCTACCGCCGCCACCAAAGTTGGGAAGTGGGTCTTCAACATGACTCGGATGCTGGGAACACTTCAGCCCC
GCCCACCACGGGTAATCTTCAGTAGAAACACTGCTGATCCGATCCAATTGCTCCCTCGCTGGCGACGATAACACCAAGATCCTCACGTAGGAACCAGCAT
CTGCCTAACTTCCATTATTTTTCAAACCATTCACCAATGCAAAACTCGTTCAAAGCTTCCTCAATGTCTTGTTGTTCAAGTAAACAGGGATAGTTGTTGA
GATACTCAACCATTCAGCAACTCCGCGGCCCATAGTCTGTCGACACGGAGGCGTTGTTCTACCAAAGCACTTTGTAGGCATACTCGTCGTAAAGAGGGTG
AAACTTGCACAGCCCCTCCTCGTGAAACTTCGGGAAATCGTACAGCCAGCAGCAGTGCGGAACTCCAGGAGCTGTGTAGCGGAACAACGCCCCTCTTTCA
TCCAGCGAGCGCAAGCCGTATGTGTCTTCCTTGTACTCGACTGTGTCGTGCATTTCCACTCTCAAACTTCGTCTCAAGCTCTTCAAGCGACCCAACCTCG
CTGTAGTGTCCGAGCAGACTGCCTTGCCATGGCGACGCCACGCCATCTTCCGGAGAGGCGAAGTAATGAGCCTCCTTCAGTCTCAGAAAATTGTTTTTGC
GACGAATCTTCTCCAAGTGGCAGTGGAAATCAAACCACGCGCAGATATTCACGTTGTTGATCATGGGTAGGAACTCGTTAGTCGCCAGCAGACGTCACTC
ACTGGAGTTCGGCCCAAGTTCGTGATGGAGTAGGCAGCCTGAAGCTTGGGGTCCATCGATCGACGAGCCAAGTCGGCCTGCATCTTCCCTCTGTAGCCCT
CGGGTGTGTACCCCGTAAAGTCAAACAGATTTTGCGGCAGGACGGCTGCGCCAAAGCCCGCTCCTAAGTCGTGGATCGAGTTGCGGTCGGCTTCTTGAGG
GCCGTAGAAATGCCGTTCACGCCTCCTGCCAGGCTCACGTACGTGTGCACCTTGTGGTCGTCCATCTGCTCGATCACCGCGCGAGCCATCATAGCTCCTT
GGGAATGCCCGATGAAGATGTAGCCATCGGCGAAGCGTTGATCGCTCGCCACCACCTCGCGCACCGCAGCGATAGCCATCGGCACTTGGATGTTCAACGC
CGTCAGAGAGCACTCCCTCTCACAGAAAGCCAACCGGACGAACACGCGCCCTGATAATGCATCCCAAATATGCGCCCAAATCGCCCCAAATGTCCCAAAT
AATGAATTGTCTCTGTAACATTTAGGTACATATTTGGGGCCAAGTATATGACTGCTTTCTCGTAAAACTATCCCAAATATGTACCAAAACGGAGTTGACT
GATTATGGTCTATAGTCTATGGGCGAGGGCGAGTGGACGCGAGCGCGAGCCTCACTCAATGCATTCACTAATCGCCAACACCCGCCGATTAGGCGGGGGC
GTGTCTGTGCGAGCGAACGCGAGCGCTGCAACCCGATATTTTTTTTTCTAGACACCGCGCCTGGCCGAGACGAGGAACTTAGCGTAAGGGACAAGGGGGT
GGGGCAGGCCGCGCAGCGGCGCCCCCCGAGCGAAGCGAGAGAGGGGCGGGCCCCCCGCAGACCCGTCGCTAAGTCCGCAGACGAGAGCCAACGCGCGAGT
GTCCGCCCTGTGCTGCTCTTTCATACTGAAGGTTATTCTGTCCTAAATATGCACCAAAACGTTCCCATGCTTAAATCATTTGGGAAACTTTGGGATTTGG
GGCGTTTTCGGGGTGCATTATCCAATACCCGCCCTTCAGCCGTCAAGTTCGCTTGGTAGTTGAAACCTTCCGTGCTGTTGCCTGTGAGCCATGGAAGAAG
AAGACTGGAAGGTCCTTCTTCTCGGAAACGTCGGAGCCGGTTGCAAGTGTGTTGGCGTTGAGGCTCGTCGCCACAGACGGGAGGGAAGACTCGTCGAGAC
AGACATCGTTGCCAGACGGCATGACGTTGGTGATTGGCGACGCCGATGCCAATAGCGGAAGCAGCAACAATGACAGCGCACGCATCTTGGCTAGATATCC
GACCTGACCTTGACGCGGAGACTTGACCAATGATGAGTGCACCAGGTCCAACTACAGAGGGATGTGATCAGAGACCAAGCAGAAAACTGAAGTTCAAGTA
CCTTTGACTGACTATTATCCTTCCTGTTCGCTTACTCCTTCTGCGCGAGGAACGCGTAGTCCGTGTATCCGCTCTCCAGAGGCACGTCTGGTTGAGGGTA
GAAGGTCTTGGGGTTCTGCGCGTTGAGCTCCGCGCCGACGCGTAGACGCTCCACGAGGTCGGGGTTGGCGATGAAGTCGCGTCCGAAGGCGACGAGGTCT
GCCGCTCCTTCCTCGACTGTCTTGATGGCATCCTCACGGTCGTAGCCCGCAGCCGTGACCAGCACGCCCTTGTAGGCGTCGCGGAAGTGACGAGTGACGC
CGACTTCGGGCACCTGGACGTTGGCTGCGTGCATTCCTCGACGCTCGATGAGGTGCACGTACGCCAGGTCGTAGTCGTTGAGCTTGTCCACGACGTAGCC
GTAGGTCTGGCTGGGGGACGAGTCTTTGCAGCCGAAAGTGTCGCCGAAAGGAGACAACCGGATGCCAACTTGGCTCGACGGTAGACTGGACAGAATGGCC
TCCACCACCTCCAAGATGATGTGCGCGCGGTTCTCAATACTGCCGCCGTATCTATCCGTGCGCTTGTTCATGCCGTCACACAGGAATTGCTCCAAGAAGT
ATCCATTAGCTGCGTGGATCTCGACTCCATCAAAACCTGCGGCGATGGCATTCTCCGACGCTTTCTTATAGTCCTCAACGATGCTCGGGATCTCCTCGAT
CTCCACTGCGCGAGGCGTGACGTAGTCCTTGCGACCCTCGCGCGTGACGGCGTGCGACGTGAGATCGTCGACGCTCGTCGCGCTCGACGACACTGGCAGT
TGTCCATCCGGTTGGTTGAGTGGGTGACCAACGCGTCCCGTGTGCCAGAGCTGCACGAAGATCTTGCCCCCCTTGTCGTGCACGGCCTTGGTTACCAGCT
TCCAGCCGTCCACTTGGTCTTGTGTGAAGAGGCCGGGGGCACCAAAGTATCCGCGAGCTGTAGGGCTGATGTTGGTGGCTTCGGCGATCAGCAGACCTCC
ATCCGTGGCTCGTTGCGCGTAGTGCTCGGCCACTAGAGCGGTGGGGACGCCGCTGTCACCAGTACGGAGGCGTGTCAATGGAGCCATGACGACGCGATGC
TTGAGCTCGACGGGGGATTTCTTGCCGCCAAGAACGAACGGTGTGAAGAGCTTCGAGGCGATAGCGGAGACCATGACGGCGGCTATGAGGTGGACTTTGT
GTTGAATTGGTGACTTGCTGGTTGAGCTGCAAATTGAAGAATGAGGTTAGTGGAGACTTACGCACGCTGCCCCTCACCTTCTAGAAGCGACCACCCTATA
GACGGTGTAGCGATGACGGTGTCATAGCTGATTTCGCATCATCAGCTTCGTTGAGCTTACCTGGGCTTTGTGGCCAATTAAATGAAAACGTACGAAATTG
CTGATGATATTGTAAGATTTGGTATTGGACACCTGGAGATACAGACCGTTCACGTTATCGAAGGCGCGATGTAATAATCCATTTCTCGAGCTTAGTAATC
CTCGACCATAGCTCGCATCATTCCTGCTTTACAATCTAAAACAATGTACTAAGGGTGTGTTCCTCAGTTCCGCTGTTTGATTCCGTCGGATTGAGCAATC
CGCCTATTGAGAAGCATTCAGCGGATTCCGCCATCCGCTAAACCGGATGAGGAACACGTCCACCGGCATCCGCTACCCTCCAAATTGCACTGTAAAATTA
CATTAAACCATGTGTATTATGGGATAGAGTGTATGCAATTAGAGGTTCAATTAGTTGCCTTTACTTTGACCTAAGCTTACGTCAAGTCCTCCGCCAAGCC
CTTGTTTGCCAAAAGGCTTCGAGCACTCGGATCGTTGCCGGACTGCAATACTCACTGTCAGCGTGCACCATATTTACCGCGTGTTGTGCGCTGTCTTTGC
CCTTCACCCTCGTTTGCCGGGGCACTTCCCGTCGTCTTCTCCTCCTCGTTGTACTTACTGAGTGACTAGCCCCCTGCAGTAGTTGCCTTGCTTGCTTGCT
TTGCCCGCAAGTTTACTGAATGCAGTCAGTCTTCCCTGTACGGCAAACTGTAAGGGGCTATGAAATCAAAGTGCCAGATCAGCAGTGCATTTTTACAGCA
TAAGCTCAGAACACATCCTTATCACAATAAGCTGATGCAATTGCGTGCGTAAAGCGAAATCGTTGGGCTACACTTCCTAACGACGAGCTGTCGTCAAGAC
AGCACGATAGCAGGTCAGTTGGCCACTGCTTTGGTGTAGGGGACTCGATCTTGCTCGTGACTCGTGAGCAGGACTCGCCAATACTCTGAATACAGTTGCT
ACTTCCAGTGACATTACGACATAATTTACTGACACTAACAATTCAAACGAAAGGATGTTGGTATGCCCATCAGCGAAGGAAGTTGGGTATCATACAACAA
ACTAACAAAATGTCTTTCATCAGCACCACAAATTGTGATTCACAACGAGCGAACGCTCCAAAATGTATTGAGGACGAGTCTGTGCGAGTCAACTACTCAC
TATCCAGCTCCACCGTGCCCGTCAACTTTAAACCGTCTGCGGCTACGTCTACTGGTGCCTACGGTGCACGACGCGGGATCTGGAAACAGCGAGATGCCTC
CGAGCGAGGGCAAGCCTCAATGACTAACGATAACGCAGATCCCTTCACACTACATTTGCGGATGGTGCCTAAACGCATCTAAACGTAAAATGCTGTATAA
TAGTGTAGGAGGTGCATGTAGAAGTTTAGTAGCTGGCCGCTTGTCAAGAGGCCTGTCGTACTTGAGATCGCCGTCAGACTACTTGCTGTCGGCGTGGTCC
ATGTCCGCCGTGTGCTCGTCATCGTAATCGCTTTGGTCTCGTCGTCCTCGATGAACTTGCTGTGCTCCTTGGTCTCTACTTACCTTTTGCTGTTTTGAAC
TTACAATTTGCAGTTTTGAAGTTGAAAATGTGTATATATGATGATCAACACGACGTTGAGGACGTTTTGAACGAGTTTTGCATTGCTGAATGGTTTGAAA
AATAATGGAAGTTAGGCAGAACCTGGCTCCTACGTGAGGATCTTGGTGTTATCGTCGCCAGCGAGGGAGCAATTGGATCGGATCAGCAGTGTTTCTACTG
AAGATTACCCGTGGTGGGCGGGGCTGAAGTGTTCCCAGCATCCGAGTCATGTTGAAGACCCACTTCCCAACTTTGGTGGCGGCGGTAGGTTGCGTTCACC
ATATCTTCTCCGTCGGGGTCGTACTCGTGGTTGGTGGCGATAGGTTTTTCCTTACTGCCCATAGTTGGGGGAGGAGGACGGAAACCATCACGGCTTGGGC
GCAAGTGGCCCGGAAATTTGCCGTCCCCACCACGCATGACACCCTTGGGGGGGGGGAGGGAATGGAGGCTGCTTTCCTTTAGGAGTGTGGAGCTTTGAAG
CCTCGCCACTGCCCTGCCTAGGAGGCGTCGGGAAGTTGAGGGGAGCACCATCCTGCCAGGGGAACGGAGGGGCAAGATCGTCGCCTACGTCTGACGGTGG
TGGAGCTTCTCCGGCATCACTTCCACTACCAGGCCATGAACCAAACCCACTGCTGAGATGGCACTCCACCTTTTCCCCTGTCCGCAGCAAAGGGATCGCC
CGAATCTCCATGCCCGGGTGGTTGTTGGCGAAATGATCACGAGTGCTTTTGCCGTCAGCAGAAGGTGGAGGAGGAGGATTGCGATTGCCGAGTTTCTTGT
CGCCAAATTGCTTCGGGTGGCCCTTACGAAATGGCCCATGGTTCGAAAAGGGTGGCATTTCACCGTCCCCGGCATGCGGTGGAGGATTGTCGAAACGACC
ATCAAAACTTCTGCTACCGTGCCATGGTCTACCTCCTTCGTCGCTCGCATTGAGAGAAAAGTCGGCACCTCCTGCAACCGGGGGCGAGCGATGGTGCTGC
CCACCGCGAAACATGCCGCCACGCTCGGGTTGCTCCAAGTCGCGGCTAAAATCGTTCGGGGGAGGTTCGTCGGCGTCGCTGTCTGAAGGACCAAGTCCCG
TGCCACTACTGGTCGATCTCCCGTCGCGCAAAAATTGCGAGTGAGGGCTGAGCGGAGATCCCGGGTCGGAGGACCCTTCGACGATAACTGCAGCCGCACC
CACCGCCGCGGCGATGGTGACCGTGAGCTTGACCATGGACGCTGGACGGGTGGTGGTGGGTACTACTGGTAGGCTGGTGCTTGAGTCACGAATTGGAGAG
TGATGAGAAAGTGAAGAGGTGGCGCACCGTCACTACATGGTACTTTACTAGCGTGGGGCGTTGATGGGATTATTCATTCGGATAGCGAAACATTCAACGA
CCATCGCATCGGCTTCGCTGTTACAGTGAATGATATACACAATAGCTCGAACGGAGAGCTAGGGCCCACTAGGGTGTGGCTATGGTGGTCAGCGGTGTCC
TACGGCAACTCGCTTCTTATAAAACCGGAAGTCTCGGTATTCATGGGTCTAATCTGATCCGACGAGCTTCATACTGTAGCTGTAGGCACCGCGCACGTTG
AAGCATAACACACCTCGTACCTGAGACGGTTTCTGAAGTTATCAGACCGCTTGGGTCTCAAGTTGTTGTCGATCGAGCGTCGATCGAGCGTCTGGCCAGG
CAAAGAAAGCCTTTGGGCCAGACTTGAACGTGTGTACGACACCCTGGATCCGAGTGTTGCTGCTGTGGGTCATGGCCAAAAAGCGCAAACCGCAACTGCT
TTGTTAGACGTGCGGGCCTCCGTTTGTTGCGTTGTCTGGTAAGTAATAGCTGCGGAATGCACCATGGATGCTCTAGCGTATTATTAGCCGGCAACGCCGA
ATTCCCCCTTGTTGCTCGTCATGGCGAGTCGAGTCGTCACGCTCGTCACCTCCGGCAGATGGCTCTGAGACGTGGATCTTCGCGAACACAACGCAGCATA
CACGATTAATAATTAAGCCCTGTAGTGCCCTGAATCCTTAGCTTAGAGCTCGACGCTCGCAATCTCCGCCTCCACCCGAGAGCAGCGGAAACCGCAACCA
GTCCGTTCAGCATAGAAAGCGGTGCCAAAGGCCCAAGTTGACACTGGTGAACAACCGGTCCAGTTAGCGTTGCTGTTCAACGCCAAGCTCGAAGGACACG
AAGGATGCCCGGCTCACTGCGCAACGCACATATCCATACACCGTACAGCGAGATGGCTTCCGGTCGGTTTCGGCTCCAACTGCACCGAAAGCCGATATCG
GAGCCGGCACCCTTGACCGACAGCTCGCCTCAAAGCGCGGCGGTGTTCGACAGCGACAGCCGCGGATCGCGATAGTGGAGTGGCGGGGCCCGCGTACTAA
GCCTCGTGGTGCGTGGCGGGTCCGTTACAGCCCGTCCTTCGCGTCAGTCGTGGCGCCATGGTTTCAGCGCCATCGGTCCCATGCGCCATCGGTCCCATGC
GTGTCAAGACCGTGTGGATCGATCCACCTGCACGCCGATCGCCGCGGATAGCCCTCTCAGCTGAACATGAAATGGCTCACTCGGGTCAATTGATTTTCCT
GCTGCTCAAAATTCGTCACTGCATATCCGTGCGTGGTGCACTGCAGCACTGCCAGCCGATCGGATCGCTGCGGATAGCAGGGTATCGCAGACTCCCATGA
TATCGGCGGGCCGAGTGCGAAGGTGCGAGCTTTTGCCAGTGTGTGTGGCCGAGTGCGTCCAGCAGCCCCCGCACCAGTGCGTAACGAGCTTATCGCGGCA
GATGCCGTGGCTAGAGAGACCATGGTGTAGGGGAGTAGCCATTTGGGTTAACTGCGGAGCCCGGATACTGAGGAAGCCATCAATCAATGCTCAATTTTCT
CAGAATCCGGCCGATTTTATGGTCTCCGCCAACCAGCTGCGCGCGAGCCCTTTTCGGCCAATCGACGCGCGGCGCAAACCACACAGTGTCGGCGAGAGCT
GTTGAGCCCCACAGCCGCGCGCAAGGAGCGGTGAGCTCGCCTGCTTCACGCAGTGGACACGCATGAACTCCCGCCAAAGGCGCCTTGGGCTGCAGGGTGC
TTGGGGCGCAGATGGAGGGCGGAAAACCGAAGCGCGGTGGCTTGTCTCGCGTGTGCGCCGCGTTCATTGGCGGAAAATGCGTCGTGGGCCCGTCACTGGC
CGCGCGCGCTGAATATTTGCGCGGCCGTTTCCATACTGGAACCAAGTCACTGGGCCCCTAATCACCGCCAGTCTCCCTCTTTCGCACGCAACAACCAGGC
AGCTCGCTCCGTCGCGGAGCGCTCGGGTCACAACGGGAAACCTCCAGCGAAGCGAGGAAGGAAGGCGAAGGCACCGAGGCAACTTAGTGTATAACCCCCT
GTCGCTTTAACACCACCTAACCTGGCTGCACCCCGACCCGGACTCTCGGCTTAAGTGAATCACAGCGGCGGAGAGGTGCGAGGACAAAGGAGTGGAGAGA
GGCGGTATCTCTAACCAACGCCCCCGAAACTACGGCAAGCAGCGAAGTCCGAAATTAACACAGGGCCCCAGTATGGCGCAGCGCGGACCGTCGGGTCACG
GCGAGATGGACCGCCGCCGGCGCGCGAGCTCCAACTACTTCGAGCTGGACGCCGACCGGCGCCGCAACAAGTCGGAGCGCAGCGAGCGCTTCAGCAAGCG
CCTGGACACGATGGACGTGATGCCCGCAAGCTTCAAGGGCGCGACGCTGGACGACGAGGCGGCCGTGGACTACTGCTGCGAGTTCCTCAAGGCTAAATTC
GGCTTCCAGGAGGGGTCGGTCAGCAACCAGCGCGAGCACGTGCTACTGCTTTTGGCAAACGGCAAGGCGCGGTGTCTGCCCAGCGACCCGGCGGACCAGC
ACCTGGTGCAACTCGCCAACAAACTGTTCAGCAACTACCGTTCGTGGTGCAAATTTATCCACACGAACCCGGTGACGTATACGGGAAATGGCATCCCGAA
CTCTACAGGTTCCGGCAATTTGCACATGGACGTGATGCTCTACTTCCTGATTTGGGGAGAGGCCGCCAATATCCGGCACATGCCGGAATGCGTGTGCTAC
CTGTTCCACCAAATGCTGACCATGGTGAACGCCGACCCGCAGGGCCACGAGCAGCAGCGCGAGGGCTGGTACCTGGACCAAGTGGTGCGCCCCATTTGGC
GCGAGGCCAGCAACATGAAGCGCCGCAACGCGCTCAACAAGCCGCTGGAGCACGTCAAGATCCGCAACTACGACGACATCAACGAATACTTCTGGAAGCA
GCACTGCCTGAGCATCCCCGTGTCGCAGGTGGGCCAGGAGCTCACGCAGAACCACGGCAAGACGTTCTACGAGCACCGCAGCCTCTTCACAATGGTGCTC
AACTACTACCGCATCTTCCAGTTCAACATCATGTTTTTGGTGCTGCTTACGGTTCTGGCATTCGCCGTGACGATTTCTCCGGATGGAGGC