Description :
From Genome Similarity Track
Location :
Scaffold_53:133232- 134941
Transcript NameFunction/comments
Phyra_80835protein phosphatase 2 putative

Sequence
1709 bases(100 bases per row)
CGTGCCCCCAGCAACGTCTCGCTTCCGGGCCTTCACGGCGGCTCTGGGCTTGACATCCGCCATGGCCCGGTCTCCATCCAACCAATCGTCTCCGAGCGCC
CTTCGCCCCGTGAGCGGGGCGTCCCTCCGGTCGCTCTACGGCAATTTCACGCTCTTCCTGCGCGTGCACTCGGCGCAGCACTTGCCGGCCGTGGCCCAAG
GCTCGTACTGTAAATTGTACTTAGGAGACACGCCCATGATCGGCGGCTTCGGCCAAGGGAAATCGCTTGTGAACACGGAGAAGCAAGCCAGACTAGGGAG
CAGTCACCAAACCTACCATACTAAAGTGCAGATGAGCGCTAAAAGAGACAACCCCGAGTGGAACGAGAAGTTCCAGATGAACGTCCGAGACGCCAACACG
GAAATCCTGACGATCCGCGTGAAGAACCATGTTCTGTTTTACAGTCCGGCCATCGGGGCCTGCGTCGTCCACTTGCGGCAACTTCAACTTGGAGTTACCG
TCGACGAATGGTTTCCTTTGTACAAGAACGACAAGGCGTCGGGGCAAATCCGACTGCAGATTTGTCTACAACAAAATGTACAGACAATGATGCCGGAGAG
ACGGTACTCGCAACCGAGTGAGGGAGAGATGCAGCGGATGATTCAGGAACATCGAGAGCAACAGGAGAATGCGAGGAGGGAAATGGAGTTGAAGCAGCAG
GAGAAGTGGAAAACGATGGAGGAGGACGAGGCTAAACACATTGGATTGAGAGAGCAGATGGAGAGAGAAGAAAAGTGGAGAGAACAGTGTGCACAACGAG
CGGTGCAGGACCAACAACGTGAAGAGGGACAGGACTCGGATTCGGACCTTCCCGAGAGCTTCAAAAATCGAGGTGTTAAGAAGGAAGAGGAAGACATCGC
ATCTCAGTTGATGAGTGAATTGAGTCTGAAGGAGAACAACATGAAGCAGTCAGTGAATTCGGCCGTTTCTAGTGACTACACTGTTTATGGCGTCAACTCT
GCTACGGATTCTGATGATCGACGGATGACTGGGTTCGGAACTATTCGGCTTTCTGTGGAGGAGCTGGGCCAAGTTGTACAGAACGCGTTGCCAACGTCAG
ATTCTTCGGACTCGACGTCGGAGCTGCAGCAGCGTCGTCGTCAACGCAAAAATCGTGATGATAAGAAGCGAAGTCATCGTAAGCCGAGAAGGCATTCAAA
GCGACAAGCTTACAGTGAGGACGAGTCTTCTGACGTAAGTTCGCCATCTTCAAGGGTGTACCGCAAGTATTCTTCGCAAATCAAAACTCCCGAAGAAAAA
ATCAGCTCGAAAAGCTCGATTCCTGGCTCGGAGTCGTCTCAAAGCCAAGTTGGCAACCAAAATGAGAACCGTCAAGACTGGGATATTCCAAACACATTGT
CATTCCCACCCAGCACCTCTGTTAAATCGTCGGATGAAGAAAGCCGCCGTCGCAGGCGCCGCAGAGCTAAAAGGGCAACGAAGCGGGAGAAGGAAAGGAA
GCGCCGAGCAAAGCGGAAGTCTGCAAAGTCTCGACGGGTATATGATAGCAGTGATTCCTCTTCCTGTCTGTCATCATCGTCGTTATCGTCCTCCTCATCG
CTTTCGTCGTCTGAAGAGGAACGACTCCGGCGCAAGCTCAAGAAAAAAAGGGCGAGGAAAGCCAAGGCTCGGGCTTTGCTAGCTGAAAGTGGTGGCTCAC
GGGCTTCAA