Description :
From Genome Similarity Track
Location :
contig_60:133222- 157729
Transcript NameFunction/comments
g9073.t1hypothetical protein
g9074.t1hypothetical protein
g9075.t1hypothetical protein PHYSODRAFT_474162
g9076.t1hypothetical protein
g9077.t1hypothetical protein
g9078.t1hypothetical protein
g9079.t1hypothetical protein

Sequence
24507 bases(100 bases per row)
TAGGCCAGCTAAATGGGAACGCAGTGAACGTCAGCAACAAGATGATACACTTTTGGGGCGTACGACTTGACCTTCTCCACGTGCTCGCACGTGATGGTCC
ATTGCTTATCGTACTGCTGAGCAAGTTCGCGCATCGTATCCACCACACGTTGTTCCCACGCTTCGCGATCCTCCACAGCCACGTTGTCGTGTACGTGGAA
CCAGCCACCGCTGGGCTTCAGCACTTGCACAGCCAATGGCCAAGCCTTCTCACTCGTAGGCAATAGTCCCAGGTTCACACGGTCTGCCACGGCTCCGATC
GTAGGGGCCGACTCGCTGTTGTCACCGAGGTACACCTTGCACCTATCTGCAACATGGTTGCGCTCCAAGTTGAAGCGCAGAGCTGCCACTGAGTTCGGAT
TCCACTCGCAAGCGTGGACAAACGCAGCGCCTCCGTGCACAAGAAAAGGTAGAACGTAGTAACCAATGCCACAGAAGAGGTCCACGATCGTTTCCCCACG
GCACCCGATGGTTGCCATGCGAGCCTTTTCGGTGACGTTGCCAGATGAAAACATAACTCGCGTAAGATCCCAGCCATAGACGATTCCGTTCTCACGAATC
TCCACCCAGCCCGGGGCCTCTTTGCTGCGTTGAGAGGTAAGAGCCTTTTGATTTATGTACAGCAGCTCCACGTGACTTTGACGCTTTTCACTCGCATCAA
TGAAGGCCTTGCGTGCAACACGAGAGAATGCAGGCGAGGTGGACGCACAAACGTGTGCCCACATTTCGTATGCGAATGGTGCCCACTCTGGCTCCAAGAA
GGAATCACGAGGGATCAGCAAGACGTCGCTCACGAACTCGTACTTCTCTGGAATGGCCTTCACAACCTTGGCAGGGAGTCGATACTTGCTGGCAAATGCG
CCGATCATACTGCGGATCGCCTCGTTGCGGTTCAGCCCACTGGTCTTTCCAAACTTGTTTGCGTACGCATCGTCATCTTTCACTACCTCAAGCCTTTGCA
GTCCAGTCTCATCCGTCGAGGCAAGCAGCTCACGAATAGCTGGCGTGACAGGAAGAAGGAACACAGTCGTTGGCTTGCCTTCGCCCATAACCTGGCTCGA
TTGTGCAGGCGTTGCAACATGAACACGCCGGGACTTGTCGTACACCTGTGCCCTCTCCAACAAAGTCTTCACCTTCTTCACTTCTAATTTTCCAACGAGA
ACACCTAGCGGCTTGTCATCCGAAGTGGGCAGCACGCTTGTAGAAGGATATTCGCTGAGCTGGCCTTGACATGTGACAGCGGTAATTTTAGGGGCCGCCA
ACGACAAGTGACACTGAAACACCGAAGAGTAGAATTGGCCGAAGCCAAAGCATTGGAAGCCACCGCCTAAAATGTAAAGCGATTTGTTGCTCGGAATCCA
AGTGGTGCTGTGTCCCACAAAAGCAGCATTTTCATGCTTCAGTTCTCCCAGCTCCGTCCACTGCGAAGCCTCGACATCCAGTTTATACACTTTTCGAGTC
GCCTTGTCACCATTTGCAAGCAGAGCTGCAGTCATGCCGCCTACCACAATGACTGAGTGATCGCTAATTGAGGTAGCGCTAGCTGCAAAAAGCGCTGGCG
GCTGGCTTTTGTTACTGCCGTTCTCGAGAACCTTGCGTTCCCAAGTCTCCCCGACAGTATCGAAAAGCATGCACACAGCGCTATCGTCACCACTCTCGCC
GCTGCCATCCACGCCATCCAATGATGACATGCCTCCCCAGAAGACAAGCTTCGTCGAGCTGACAGCCACACCAACGTGATCAAAGCGGCGCGGGATGTGG
ACGTACTCTCTGCAGACAGAGAATAATAAATATTTAGTACACTCCGAAAAAATGGAGTAGGCTTGGAGTTTGGCTTACCGATTCGACGCCATTGCGGCGA
GTTCTGACTGAGATCTAAAGAAAATAGATCTCCGAAAACTCGTTCAGCATCGCGGCCACCGTACACGTACACAACAGAGCGAACTGCAGTCACACCAACA
CCAAGCATGGACAGAGGTTAGAGCACTTTGTGATTCCAATTCGTCAAGTAAGAGCTTACCAGCACAGCTGCTGTGCTTCCAACGCGGAGAGGGGCAGACT
CCTCGCGGATGAATCTGCTCCCACAGCTTGGTCTCAATATCCAACGCATACAGGTCGCCCAGGGGTTTCGCGGGGCTGGCACGACCACCAAATATGATCA
TGCGCGTTCCTACAACAACAGCGGAATGGTGCATCCGAGCTGATGGACCAGTAGCTCCAGCGGCAGCGTGGTACGTTTGCTTAAGAGAACCGTCACTTGA
TGGTGCCAGAATTGTCACGTCCGCAATGCGCGTCGTCGTTCCTGACGCAGTCGGTCCCTGTCCACCGAACACAATAATGTTGTCCTGATACTGCACACTC
GTATGCCCCACAAGCTTGACGCCGTCCTCGTTCGTCACCTCCGTCCAGGACCTCAGTTCAACTGAAGAACCACTCCCAACTTGCTTGCTCACTGTCGGCT
GGCAAAACTTCGCGAGGAAGGCGTCAAACAGTCGGTCCGTCTTCTGCTTATTCGCCTCAAACTTCTGGTTCGCGACATCCACGATCCATTGGAGGTACTC
CTCGTCCACCAGCAACTGCTGCGCACTGCGTCCAAGCGGAATCTCTAATCCGTTCGCGGTTGTGCGAATCGCGCACATAATTTTCCGGTTACCAAGCACG
ACCCCCGATTCGCGGAATCCGCTGGCGATGCCCCACTGCAGCAACTCCTTGGCCGCATCCAGGTCGCGACACACCACGTGCATGATGAACGGCTCGTGCT
TGAAAATAACCTGCAAAAGGCACAACAACCATCAGCTCAACACCATAAAAACAACCTAAAAGAGTAAAAATCGTCAAGTGTCAACCATGTTGCTGGTGCT
GGAATTGGCGTCGGGTGACTGCAGCGCCGCCTTCAGTTGGTCGAATGTGATGGTACTATGTTCGGCGATCAACCACTTGCCGCCTTTGGTGATCAGGTCC
GTCGTCGCTTCATTCCCATTGCCCGTGGCCGCTTCACCGCAGAAAACTGCAATTCGCCCCGAACACGAGCTGCTCGTCACCTGTAGCAACATGAAGAACC
CATAAATGAGCCCAATTTCCAATTGCAATTGCACCAAGAATGATCACTCACGTAATTCGGGTGGTCGTTGATACTCTTGATCATGTCCACAATGGGCTCG
TCAATGCAGCCCTTGGGGCTCTTGTCCTCCATCGCCTGCAGCTTGCGCAGACTCTCGCGCTTGAGCTGCGCGAACATCGTCCAGCCAGCCACAAAATGAC
CGTCACAAAACCGTCATCGAATTTATTTTCCTAAGTACGTATCAGAATTTCCATTTTGAGTATCTACTCAAAAACTTTCCCTGCATCATGGCCGAGCCGC
GTCTCCGCGTGCGTTGCGCCGGCGTGCGCATGAACCAGCGCGGCATGTCCGACAGCGGGCACGTGTTCTTCAGCGAGACGCAGTACGCGCGGTCCCCGTT
TCTCGTGCGCGTGAGCTTCGACAGCGTCGCCTTCGTGCACCGCGGGACGCACGTCGTGGAGCGTCGCTTCGACTTCCCGACGCGCGTTTTGCACGCAGTG
CTGGCGGACTTCTCGCCGCAGGTCCTTAACAATACAATTCACCAGTATGCAGGTGCGTCGCTGCCCCAAAAGCGCGGAATTCGCCGCTCCATCCCCGGAC
GCACCCGCACCTGTGCGTTTTGGTGCGCTCCGACTGCTTAAACATCTACACTGCAGCCGGACAAGTGTTCGAGGTGGCGCTGCCCTTCCAGGCCAATAGA
CTTTTCCCTATGGAAGGCCGTGGACTGCTGCTACAGCGCAGTCCGGCGGCACAGATCCCGCCCACGGCTTCGAAGCGTCCGCGAGACGCGGCGGCGGCGG
CTCTGGCCAAAAAGAACCGGCGAGCGAGCACCAGTAACAGAGGAGATGGAGACAGGTACAAGTACAGTGCTGAAGACGATGGTACGCCTGCGAGACCAAG
GTATTTTACGCTCAGACACCCGCTGGATGAGGTCAAGCCAGTGGCGAGCAAGAGTGAGGAGGAGTTTCTGGCGAGCTCCGCGTTAGAAGCCGTTGCAGTG
TTGGTGGAAGGAGCGTCTCTTGTTTTAGTGGCTTTTCATCGCTGGGAGCAGAGGTTTTGCATGTTTCGACTGAGTGAGGTGGAGAGGAGTGGAAGGGATC
AATTGATGCCGGAGGTGCGGGTGGTTGATGGACCCACGTGGACGAGATACCGTGCTAGGATGGATTTGGAGGAAATACGGGTGCCGATTGAACCCGAGTG
GCTCGCGACGCCCGTGTGGAAATCTCCTCGAGTGGGACCCGCGACGTCAAAGCCGAGGTTTCTGTCCTCGATTATTTCTCCGCCAGCGGCTTCACCTGCA
CCGCCGTCGCCATTGACGGCTACTCCGTCGGTTTCGTCAAGGAGTGATTCGAAAGTGGCTTTCATTGCGTCCGGTGTTGATGGCTGCCCTTTGCTCTGTA
TGATGGACAAAGGGGTTGGAACGCTTCTTTTGAAGCCAATCTCGCAGCAAGAAACTGGTACTGCGATGCTGGCTGAAGGTGACGGTGAAGCTGGTGGTGT
TCGTATATTACACTGCCGTGACGCTGTTCCGATCTGTCAGCATGCAAGGCGATTTGAAGGTGGAGAACGTTCCACAGACAATATTCCAGGTTCCACCGGA
TATTGTAGTTCTAGAAAAGGATGGCACGCTGATGTTATATCGAGCACACCGTCCTGTTTGTCGCCTCGATCTTCCTGCTGTGGAACAGGATTGCTTCGTT
GGCAGTGCTGCAAAAGATGGGGCTTCGGAAATAGTACGGCTGATGGGCAATGTTCAGCTAAGCTCAATTGACCGAGGACATGCGTACGAGCTCGTGTATC
CGAATTTACGCAGCAGCAAGAGCGGAAAGATTTGGCGGTGCGAGCACCCGCTGAAGGTTGTGAGCTCTCCTCTTTTGCAGCAGGTTTTCGATGTGCTGGA
TTGTATAATCCCACCTACAGAAATGTGCGAGTTTAAAGCACACGTGATTTATCGGGCTCAACAAAAGACTCAAACAAATCGGAAAGATGATCAGCTTGCA
AATGGTGGGGTCGAATGGCAATCTTTAAGGAGTGCGTCATTAATATGCTGGAGGAAAATGCTGAGGGTAAGCCAGCAGCAGGAGGACTGGAAACGACGAG
GAAACGGCAATCTCGTGTTTTGATGCGCTTTGCCAGAGTGAGTTTCATGGCATGTATCAGTACGAGCATGCAATGCTTTTTGCCACGATGGAGCTGCCCA
TCGTGGAGTCAACGACAAACAGATCTCCCGAAAAAATGCATACTGACGACATGCGCCAGTGTCAAGCAATGAAGAAATACTGGGAGACAATGTTTGGGGC
TTCATTTACTCTGTGAAGACCTGAAGTTGTCGATTACACTTGTTCAGCAACGTCTGCAACTAGTGGACTTGCTGATGGAATGTCGTCACTACTGCGTTTG
GATTCCTTTGCTGCTTATTACAAGAAAGATAACTCTGTGCTGAGACGGCAAGCGAATATGACGATGGAATTTCGATTGCAGGCACCTACGCTTGGAGAGG
GGCTACTTCGCTTTACTTCCTACGGTTGTGTGCCGGACTTGGTTCTGTGGCTACAGAGCAAAATGACTGCGAAATCGCAGAGACTGGCAGCGTTTCCCAT
GTTATTGGAGGATGATGATCCGCGGCAGTTTTCTAGAATTTCTCCAGGACGTTTTGTAGGCCCCTTTCGGCGGACAAGAGCAGTTTGTCACGCATACGAG
CTGATGTTTCCAAGCTCAGAAGAAAACGCGCAGACAAAGGCTTTCAACCTGATCGTTTACCTCAGTCAAGACCCCATCGGTAACGCTCTGTCTCTGGATG
ATCTCCCGGTAGGTTTAAGTTTTCCGATCGTGCAAACCATTCGCCACGTGAAGCACCACCCACCCCCTTCCATCACTGAAGACGTGAGCGCATTTGTGGG
GCGAGAGGATCTCAGTATTGCAAGTGCGGAAAGCCTGGCAGATCATGTTGACTATTCGACACAAAACCAGAAACAGCATGATCCAAAGAGTAAAAGTCTT
GATCTCACTGAGGACGACAGTCACGACGACTGCGACGGTCTTGAAGACATTATAAGTCGGAGTCAGCCCCTCTTCCCTACTGACCAGAGAATGAAGGAGG
TTGCACGTTTGCTTCGTTCAAGTCGCCCTCTCTGCCTGAAATTAGAGAAGACGCCGGATTTGTCAGACCTGGACTACGCGCAACAGCAGCAAGCCCGTTT
GTTGCTTCTCTGTAAACGGTCTATGGCGCTGTCTGTGGCGCGTGGCATGGTCACACTAGGCAGTTTTGATGTTTCTGCCGCGCAAACGCAGATATGGCGA
CTTTCTATACCTGCATTGCCTCTAGTGGGTCGTAAACCGCCGGCAAATGCGATTGTGGAGCTCGATCTTTCCGGCTACGCCAAAGAATTGACGTATTGGC
CTCAATTTCACAACGGCTGTGCTACGGGTCTACGGCTTCCAGCGCATGATCTCTCGGGCGTCGTCAATCGTCATTGGATTAAATACCATCGACCTTCAGT
GAACGATGCTCCACAGCGAAACCCAACGGGAAGTCAGCAGGCAGCAGCGGTCCAGTCGGTTGACTCTGCCGGCCGTAACCTGGAAGAGGCATACGCAGCT
CATGCAGGGTTATTGCTGGGAATTGGTCTACGCGGTCACCTCAAATGCTTGTCCATGGCAGATGTGTACAACTACCTATCGCTGTCGAATGAATTTGTGA
CTGTGGCGATCATGCTTGGTATGGCTAGTACCGCTGCTCACTGTCGACGCAAGCGAAAGCAGAAGACTGCAGCAGTGAAGCCTACCATGACGGACGATGA
GCAAGCAAGTGGAGACACGGAGGAACCATCGCTTGGCGCCGATCATCTTTTTTCAGGTTTCCCAGAGCTCTCATCATCCGATAAAACTCCGCTACTCGGA
ACGGGATTAGAACTGGCACTGGAGCGATCAGTATCCAAGGTGTTGTGTCTCCACGTTCCATCGTTGCTACCACCACCATTCGGAGGGTTTTCAGTACCTG
CATCCACTCAGACGGCTGCATTGTTGGGACTCGGCATCTTATATCAAGGCACGGGTTATCGCCTGATGACAGAGTTATTGCTTACGGAGATAGCGCGTTC
TCCATCAAGCGCCCAATTCGCAGGGAACAATGGAAGCGCGGGTCTGTCAACAGGTTCGTTCGATCAGCTGGAGGGTTACGCTTTGGCAGCAGGAATGGCG
CTAGGCCTTGTCGTACTGGGGCGTGGTCAATCTACAGCAGGTGACCCAGGACTGGCTGACTTGAAGCTTGAAGAGAAGCTTCACAAGTACATTGTCGGCG
GAGCCCAACAGTATCGGGATACAAACGTGGCTGGAAGCTGCCTCTATCGTGGTCGCCGTTGGCAGGCATTTGGCAGCGGGGGTAATGGTTTCAATTACGC
AGTAAACGGCAACCCCACGGCTAACGACACGCCTAACAGCAATACCGGAGCTTCTCCTGGCGCTGGCCGTGACGCAAAACACGTGAACGACCGCGGCGGG
GCTCGTGGCGGTGGCGAACACGTTAACGTTGGAGTGACTGCGTGTGCAAGCGCTCTGGCACTAGCATTCATGTACATGCAGACTGACAACAAGGCCGTGG
CTGCGCAACTGGTAGTCCCCGACACGCTTATTCTGCTAGACTACGTTCGCCCTGACATCTTGCTGGCCCGCACCCTAGCAAAGAACCTAGTAATGTGGAG
CGAGATTTCGCCAACTGTGCAATGGATTGACCAGCACGAAGTCCCAGTGCAGCTACTTCAAGCATACAAATTTATCCAGCCGCAAGCAAATGATGCCAAG
GGGCAAACGGAGAATCCTAGCGCCTCACCAATGCACTCTGACCTCCACTCAATTTGTGAGGCTTACGCGAATATTGTTGCAGGGGCGTGCATGAGCATTG
GGCTGCGGTTCGCCGGCACAGGCAACGTGACCGCTCGAACTACCCTTCGCAAGTATGTTCTACATTTTCGGGAGTTAAGAGCGAAATCGTCGTCGTCTTC
TTCCTCGATGCGTCTGCGAGGTAGTAACAACGTCGTTGCTGCTGCGACGGAACGTGCAACTATCGAGAGGTGCTTAGCTGTGTGTGCACAGGCGCTAGCC
CTGATCGATGCTGGAACTGGCAACATCGAAACGTTGACACTTTTGCGCTCGATAACATTGAGGCAGCGCGTTGATGCGGGAATGAGCTACGGCAACCACA
TGACACTCAGCATGGCGATCGGGTTGCTTTTCCTCGGTGGTGGCCGTGCCACAGTTTCACGATCGAAAGAAGCTATCGCGGCGCTCGTAATATCGCTCTA
CCCGATGCCGCCGATGAATACGGCTGACAACAAGTATCATCTACAGGCCTTCCGCCACCTTTACGTGCTAGCGGTGGATAATTCTCGATTGCTGGAGACT
GTGGATGTGAACACTAAAAGAACCTGTGCTGTCCAAGTTCGAGTTGATCTTCATCCTGTCACACTTGGCTCTAAGAGTGAAACTCAACCTACGTGCAAAG
TGTTACGCAGCCCGTGTCTTCTTCCGGATATTGCAACAATCAAACGCCTCGTCATCTCTGAACCGGATTTCTACCCGATTGAAATCCTCACTTTGCCGCC
GTCTGAAGAGCCAATGTCTTTGAAGAACAGCAACATGAGAACGGCCAACGCTCTTCGGTTGGAACTCTTACAAAACAAAAACTTGGTTTTTCTGAAGCGG
CGACAACGTAAAGACTTCGGGGGTCTTGTGGATCTCCAAGAAGTGCACAATGGACACGTGACAGCCCGGGGTGGAGGTAACGACGACGATAGAATGCGGA
GACTCTTTCGGTCCTACTTCACGACGGGTAATAGTGGTGACGATGATGACTGTGAAGACGGCGAAGATGAAGCGGGTCAATTAGACGTGGTTGATTGGGG
AAGTAGTTGGTGGGCATCCCAGTTAAACCCACGAGGACTGGAATACGTCCGAGAAGAGGCACAATTGCTTATGCCGCCATACTTGAACGCCTTGCATGCG
CTCTTTCGGCTGCAGCAAGTGCCGCAGTTAGCATGCGCCACGGAGATCGTGACGTTGAGTCTGTTCAGTGATTACTGCCGCCTGCATGCATCATCTTCAG
CGTCAATAACCAAGGACCCGGTCAGACTGGAGGGAAAACCTTCATTATCCGATTTTGGCGTTTGGCTCTCGAATCAAACCGAGGAGGCCCTAGGAGCACT
TTGGCATCGAACGTCGCTGTCAATTACTTCGCTGGCTTCTGCGCGAGTCAAGCTACTAATGGAAACCCCATCATCGTCATCACCGACGAAAAGAGCCCAG
TCACTGGCGGATGAATTCTTCGTCAGTGTTCTGGTGCGCTATTTTGCAGGTCCGTCGGTGTCGTCACTACCACTTGCAGAACAACCCCAGCGTGCAGATA
AAGATTGGAAGGCCAAGTTTCAACGAGTACTTGCTGCGTGTTCACAAGCTCAATCTCAATCGCTGAGCATGACTTCGGCGCCAGCACGATTCCAGTTGTC
AGCATTCCTCGAGCAGAATGAGCTTACGGAAGCTGAAAAGACTTTCTGGCTGAAGTTGGTATCGTTCTTCCTATTTTCCAACTAGCAAGTGAGTGCAGTC
GCAGCAGGTAACTACCATGTATGCATGAAAAGACTGGGTTTTGCTAGTGTTATTTAATTTTTATTGTCTTGCAGGCTGAGCAATGGGAGCTGCATCAAGA
TGACAGCCACCTCTATGATCCACCTGCAAGTGTGTTTCCTATCTATTCACCCCGGGTCGACGAGAAAGAGAGTTCAATCTTCGTCAAAACCGGTGACGGC
CACCGCCTGCAGTGTCTTGTCTGGTAGCGCTTCGTCGCTGTCGTTCGCGAGCCTGGAATCATGATCATACGCACATGAGGCTGCTACTCGCTTCTCAAAC
AGAAAGTCTGTTCACACTCACCATATCGCCGTTCTGCACGCTTCATCATGGTTGTCGAGGAGTGTCCGCGCAAATCCTCGCTGCTGCTGCTACCTCTTTT
TTTCTGTGGGGAACTATTTTCTCTTTTTTTTTCCATGGCATGGTGTTCCTCTTTTTTTTTTGCCACGTTTCACCCACGCCACTACTGCCCGGGCACAACC
TCCTCAATTCAGTTTGGCAAAAGTGATTTTCATTTTACGTCTCTTGCGTGGTGACGACACGGCTGGGGGGCCGCCGCCTGCTCCACGGGCTTCTTCACCA
CCTTTGCGGGAGGTGAAGTAATCCCTTGAGCCGACGCACCATTTGTCGACGTATTGGCAGAGTTGTCAGCAGCACCCAACGATTTCCCGTCCGGGCTGCC
GGATTCAACCACAGCCTTGCCATCGCGATCACGCTTACCTGTAATTTCTGGAGACGCCGACGACACCGTCTTCTTCGGCTTCACAGGAGTGCTGTGAACA
GAATCAGTGCCGTTTGTCGCCTCACTCCCGTCAGCCGCAGGATTCGGGCTACCTGGTTGCGAAATACTGCCCTTCCATTGGCCATCTCGGTTGCAAGTGA
CGCTGCCTGTTGACTGCTGCTCAAATCCTCCACTCCATCCTCTTGTGAGTGCACACCTTCATCACCCGAAGGCGGAGGGCTTGGTGCCGCGACCTCCTCG
GCCTTCTTCTCCTCTTCTTTCTTTTTCTTCATAAACTCACGACGGACAACACGTGCAACAGCGCGTCCACCCATCTCTTCGAACACACTCTCAGGCAAAG
ACTTCCAAACAACCGCAGTAACTCTCACGTCCATGGTCGCCGTTCGTTTGTTCCAGCGGTAGAGATCGTTGTTCTTGAAATACTCCACCGAGCTGTCAAT
GCTCACTTCACGACTGCGCAGCTGGCGACGGTCAATATCAAAGCCCACGTAGAAGCAGACGCCGAACTTGCTGGGCTGCGCTGGGGTTCCGCCGTTAGAC
TGCTCATTCGCTGGAGCCTCACCACCTGTCACAAAGTTCAGTGGGTACTTCTTCGTGAAAGCGCGCAAACGGCAAAGCGCCGGATTGTAGGCGAGCGACT
CCACCAGCTTACGCATACGAGACTCGCAAAACCCGCACCACGCCTGCTCCTCGTCCTGCTTCTCCGTGTACACCTCGACTGCGAGGTAGTGTTGGTGGAC
GGCGAAAAAGTCCGAGGGCTCAAAAAGTGGCCCCCATTCCGAACCACCTTTGCTCAGCACATCTTGCACAATGGTCAGGCCGCGCTTAAACTCCTCCTTC
ATAACCGTAAGACTGTGCGTCGACACGTTAAACGAGGAATTCATCGACGGGTACGCCGGCGTCAGGATCGGCATCACTTGGTATCTAAAAACACATGAGC
AATCATCCAAACTCAGTTATTCGTCTAGAAAAAAAAGCTGACAGCAATCTAGCCAACTCACCGGTTGTGGCCTGCGTTGGCGTTCCAAATTTCCAACCCC
AAATTGGCGTCCTGTGTCTTGCACAACTGGATAGCGAGCGGCCACTTCCAGTTGTTCAGCACCATGAAGAAACGCAGCAGCAGTGTCGACGGAGCCGCGG
TCGGGTACAGCTGGTTGATGAAGCACACCAAGATGCACCAATTGACACCTCCGAGGTAGCCCATCTTGTTCGAGTACAGTCCTCGACGTTTGGCCCAGCG
TCTCACAATACGGAGCACGCCGATGAAGCTCTCCCGGTTCGGGGTGAGCTTGATCATGAGCTCCGTGACTCGAGGGCCATTGAGACTCTTCTCGGTGGCG
GGGTCCACGCCCACAAGCACATGGTCGTCCAGAATATTTAAATTTTCAGGGATTGAGTTCCTCGGCAGGATGGCAATTTGTAAATCAATGTTAATCTCCT
CGTAGTCGAACGTCAGGATGGGCACGATGGCACCCTCAATAGCCACGAGGTTCGAGACCTTGGGGTGCTGCAGGAAAATGTCCTTCAAGGACGAGAAAAA
GTCCTCGCGCGTCACGTGGCGCGCGCCACGCAGATGGTGTCGATATCCGCGCCCGGTTCGTTCACCCCGAGGCGGTACGAGCCCGACACGAGGATCTGGC
CGCCGGCGTCGGCCGCCATGTCCTCGGGCACGCCCTTGTCCATGCACACGCGCTTCACCCATTGGCGGAAAATCGAGCGCAACTCGGCCAGAATCAGCGA
GCGGCGCGTGATGTTGGCGTCGGATTCCGTGGGGAAGTGCGCGTCCATGAAGCTTTGCAACTTGGCCGACTGCTCCAGGTCCTTGGGCTCGGGCGGCGTC
GTGCGGATGGCCTTGTACGCCTGCTCCAGCACGTGCGGCGCCACGGTGAACGTCGCGCTCTGCATGACGAGAATCGGCGAATGAAGGCAGCCTGTCCGCA
GTCCGTTTCGCGCTAATCTGCTTGTGTCACTCAAGGTGAACAATGCCAGCGCTGTCTCTGTGTCGCTCATTGGCGGATAAAGCTTCTAGATTTCATTGGT
GGAAAAGAAACATTATTTTATCGACCAATCAAACAACATTTGAAATTGAATTTTGAATTTGCAGCACTTCTCGTGGCCGAGATGGACGACATTGAGGCGC
TCATCGCACCAAGTACGTGCGTGTCCCCCTGGTGCTGGGGGATACAAGGCGATAATTGCTGATATATTGTGTGTGCAGAGCGGCTAATGACCGAGCGCCA
GTGGATGGGGCCAAGCTGCGACAGTACATGGCCACCGCCAACACTGAGCACGTCGGAGCGTACGGAATCTTGCGGTCATTTATCGTTTTTATTTTCTATT
TTATGTTCATAACATTGTAGCCGCTCCGGTGTCGTGGTGCGCGGCGATGTACGCAAAGACGCTGAAGGGTTGAGGACATTGACGACTTTTGGGTCGACGA
GGACTCGCTGCAGGACGACTCGGTGGACGATGACGATGACTGTGCGCGGCAGTGGCTGCAATTTGCAGGAGGATAAGAGATGCTGACCCTGTTTTTTAAT
TTTATTTTGACAGCACTCACGGTGTCCGATAAGGATGAGGCGGATACGTCGGGGGACATATCGGAGCCGAGCGAGCATGAGGTGGAGCTGCCGGAGATTG
ACAGCCCCGTGTCCAGTGGCAAAGACAGTATAGACATTGAGCGAGGATCGATTCCAGCGAGATCGCAAAGAAGCAGTGACAGAGGGATTTTGGATATTGA
GCGAGGCTCGATTCCAGTGGCATCGCAGAGAAGCAATGCCCGAGCGGAAGAGGAGAAGAAGGTTGGTGCATCTGAATCGCCGCCGCCGTCCCCCGCACGG
AGCGATATTTCGTTTGATTTTGGTGGCTCGCCGCATGGCTCCGTGGATATGGATGCAAACATCACTGTGCGTGATCGACGCGGCAAGAAGTCTACTGGAG
CTGGTGGGGATAAGGCAAAAACGAAGGCTCGCCGGCGAGAATCTTCGGGCGCCGTTCGCGGCTTTGATGAGGATGCAGCGAGTCCGTTTTCTATGAACGA
TGAGCCGGTGACTCCACTGTCAAACGGTGCGTGGTGCTTCCGGGTTAATGCATTTTATTTTCAGCGATGACTCATTATACTGCCTTGTTTTTTATCTTGC
TGCAGCGAGCGACCGTACGTTGAAGTCAATTCCGTCATTTTCGGGAAAAGACTCGGTCTCGCCGACCATCACCAAGGAGTTATTCAAGGAGGGGGATACC
GCAGCGATGCCAGTGAAAGAAAACCGAAGAAAAAACAGACGAAGAAGCCGAAAAAGGCTGCGGATAAGGGTGGTCGCAAGACACCGCGACTGCGCCCGAC
GGGAAAATATGGCTACCGGAGTACTCCACCCGCAACCGATACCTCGATCCAGTCCGTGCAGACTGACGATGATAATGACGAGTCTTTCGAGGCGCAACAC
GACTCTGGTGGCGAGACAGGAGATGACAGCTTTTACAATGAGCCGGACGCGCCGAGTGGCAGGGTTCGAGACAGGTTACCTGACGCCTCTAGGATCTTGG
ATGACGACGAAAATGATGAAGCTTGGGATGGCAGTGGCCTGCGTCGGTCGAAGCGGAAGCGTTACAAACCGCTTGCATGGTTTAAGAGTGAGCACATGGT
GTACGAACGCACCTTTGTCGGAGTGGGAACTGTGCTGCCTACGGTTGTCGGCATCGAACGTCTCGGTGCTGATTCTCCAACATCAAAACGGACGAAGTCT
AAGCCTCCGTCGAAAAGGACGAACAACAGCAAGCCCTTGAGACTGAAAGATCTGCCCAAGGACGTGCGAAAGCGCATCGTGGATAGCGAGTGGGCGACGC
TTTACGACGGTCAGGCCGGTTGCATGAACGACCTGAACATCATCTGCCGCTCCAGTGAGATCCGTCTGCGTAAGCTCCCCACGGAGGAGAGAGGCGGTGC
AGTCGTGCACGCGTACGCGGGGCAGAGTTTCAACCTTTTTAGTCCGTCCCCTTTTGCGCGGTGGATCTCTGGACGTGTAGTATTGCCTCCCGGCGCGTGG
AAGGAACCAGAGGGTGTTGGTCAAGCCGTGCAGTTGTTCTACGTAACTGGATGCCAGCCAAAGTCGCTGGAGTTGGCGGTGGCGCCCGAGACCGATGACG
ACTTTTTCACCAGCAAGCACACGACCCACTTTATGCTAAGCCCAGGCGACGAGTTCTACGTGCCGTCTGGTAATGTGTACTACGTGAAAAACCACTCGGG
CTCTGCGGACTGCGACTTGCGGTTCACGATTTTAAAGCCCGAGGCGCCGCAAATGCCATCCGACAACAATGACTCCGACGCGGAGAAGGAGGAGACGAAG
CCTGATCCGGAGTCAAAACCCGAAGCAGCAGAAGCACTCGACAACGAGCTGAAGCGCAAGCGAGAGGAGGACGTGGACTCGGACTCGGTTTAGAGCGGTG
TGCATTAGTGCTAGCAGCAGCCGTCTCCTTTATTCAGTACTTCGAAGTAGATTTGTTTCCTCTTGTTGTGGTGGACCGTCTCCGTCGTGACATTGCTGTC
ACACAGTAGGACGAGGAGCCGGAAAACTGTCTGACTCAGCCGGATAAAGCACCGGCTCCTGATTACGATCGATACGGGCATGGCATCTTCGTGGTGGTCT
CCAATATGTAGCGGCGTCTCAATTTCAGAGACTCGCATGGCAAGGAAATAAAACTACCATCGCCATTGGGTTTTGCGGCCAAGTGTCCACACGCTGTGAC
GGTAGCACGTTACAGCGTTTGAAGTTATGCGCGAAAACGACGTCGTGGGCCACAACTGGTAAAGCGTCGTCAACTCGAGCGGCGATCTATGCGCGCACAT
GCGCATGGCGCGGGTCTGCTATAAAAGCAGATGAGTCTGCCACGCACGAAGCCTCTATGGGTAGGTGAGCGAGCACAGCTGGAGGGCCTAAGAATACGCG
TGGCGCGTGGTTCGGTGTCTTGGTGTCAGACCGAAAGAGAGGGGACGAGGTTGTCAGTGGCAAAGAGACTGAGTGTCGGACAGCCAGAACACCAGCAGGT
GCCGGCAGACTGCTGCCTGTCCTATACTGCCTCGCTAGCTTTCCGTGTTGCCAGCTCCCGATTGCTTATTTATCGTTATTGCGCGTCGATCAGCTTGATT
CGCGCTATGGATCCTGCAGCTTCATCGTCCAAGTGCGTTCTCAGTTTGCTGGGTACTGGTTGCCAACTAGATGTGCTGCTCTTTACTGACGTATGGGCTG
CGTCTGCGATAGGATGGACGACGTCTACGAAACCATTAAAGAAGGAAGCGTGGCTGTCCGAGGGCATTTCATGGTACGAACGAGTCCAGTGTGGCATGAA
TTGATAGGAATATCGTGGTCTCACTTGTTGTTGGCCAACTTTGCAGTGGCGTGATCGCTACGTTGGTATCAAACCAGGCGAAATGATCATTCGTCGCCGT
CGAGACGGCACCATTAAAGCCAAGGTTTGTGTCACAACTTCGTTTATCGAGACCAAGCTCGTTCTCATTTGTTGTTGCTGCTGTCAGATCGACTTGCTAG
ACACCAATATCAAACTCACGTTCCTCGGCGGCCAGTCCTTGCTTACCATCGCTATGCACGGACGGGATACTGTTTTGGACTTTCGCTCTTCAATTACGCG
TGACGAGTGGATCAGTGCTATCGTAAGCGCACAGGAGCGCCCTGGCTCGGACGCTGACTGCGACGACGATGGAACTGAACTTCTTTCTGGCGAAGAAACA
GACGAGGGACACAAGCGTAGCTCCATGACGAGCTTGGGGACCGAAAAGACCGACTCCATAGCGGAGGATAGCTACAATGATGCACTACTTGCATTGCAGA
GCGTACGTGATTCCGTAATGCAGTGTCATCTCTCGATGAGCGCAGCCGAGGTCGACTCGTTCATTAATCCTTGCGATAACCCCATCGCAGCAGCAACCTC
AAAACGATTCCTTCACTACGACGAGCCCAAAGCGCGACGCGCAGTGAAGAGGAACTTCGACAGAAACGCCTTCGAGCACTGCTGACGATGATCGAAAGCA
CGCCTCACGGAGGACGTGTTGTGCTCTTGCACCTCGGAGTAATTGCGTCTGCAGGCATCACTGTTGGCGATATGCTGTTGGCACTTGGAGAAAAGCAGCG
GGAAAACCCACGTCGTGGCTCCTTCACTCCGCGTACGCTGAGTGCCCAAAAGCACAGCATTGCGGCGTTTGTGCGCGATATTTTGTTCCACCCCATTTAC
TCGAAGCGCGAGGAGGTCAACACCGAGATTGTTCAGGGGCTCATCGACTTGTTCTTCCCACATTGTCGGTTGAGGCGGTTTAGTGATGATACGGAGTGGC
ATCAAGTCCAGCCGTCGGCTTCGGTAAACAACACATCCAGAGTTACAACAAAAAGTGAAAATGATGCTGACGTTGGTACTGCAGTTCCGACAACCCCGAC
CGTAGCACCGCCAACTCCTGCATCGCGTCTTCAGAGGCGAAAGCGACGGAATCACTCGTTCCCGAATCTGGGTGGTATATCTCAACTCACCAAGAGCAAG
GGTTTGAAACAGACCTCGGTCGATGACAACGACCGATCTATTAGCACGCGCAAGTTGGAGGAAGGCAGCCAACGGCTACGTGACAATCTGTCTGTGCTGT
TCGCACCATTCCCAGACAGCAAAGGCCCCAGCAGCGGACCAACTCCGTTTGTGAGTATAAGCACACCATTCGCCTCCGACTCATCTGATGAACTCGATGT
AGTATGCGAGGACATACCGCTCCCCCAGCCATTGCGGAAAGTCTTGTGGGAAATGTCGTGCTCAGAGTTAGCTGAGCAGCTCACGCTTTTTCATCACTCC
CAACTCTCGAACGTGTATCCGTGGGAGTTTTTGCACCACCCCAAAGAAGCTGCCATGGAGTTGACCGAGAACTTCAACCGGTTGGTAGCATTTCGTCTGG
TCTGTACTGGTCGAAGACTCTCCAAAGGAGCGCGCAGAGGTCATTGAGAACATTATCTCCATTGCGATGGCCGCAAGTGCATCCCCGCTTAATAACTTTC
ACCTGGTCATGGCTTGCGTGGGCTGCCTCGGAGATACGCCGCTGATGTCTTCACGGATGCCGATCACGTGGAAGAAAGTTCGGGCCAAGTACAAAACTCG
TCTAGGTGAACTTCGACGGCTGTGCGACCATACCGGCGGCTTTGAGAACCTGCGACGCAAGCAGAGCACTGAAAGTGCACGGCCCATGCTTGCCAGCGAC
GTATCGACTGTCTCCATTATTCCCTTCATCGGCGTTATCGGGGTCATGCTGGAGCGATTGCGATCAATCAACTACTTCACCTCGAAGAAGATGTTGGACT
TGGAAAAACTTGAGCGGCAATACACGGTGCTCAATGTACTCGAGAACGCGTTGCTCAAGCCCGCTCCACGGCCTTCTCGGGTGCCTCAACGCGGTAAGGT
AGCCCCCATGGAATCGGCGACGGAAATGACAGCTCGCTTGCAACATTTTTTCCGGACACTCAAAATGGACTTTGCCTCGCCTCGACTGCATCAGCTACGC
TCGCAGCAAATTTTGGCAAGCGAAACGAGCTCCACGAGCTCAGCGTCGGCTTCTTTTGTATTATCAGCAACCGTCAACGGGAGTAACAGAGGCGGGGCCC
CATTGACTGCAACGACCCTGGCAGTGAGCAAATATGACGCGCAAGGTTCTGTAGGTCCAAGTGAAGACTCTGGTTTGGCATTCGTGTCCTTCCGAGACAT
TTGCGTGTTGTTAGTGTCTGTCCCGGAGATGCGTGAGCGAATGCAGATGGCTCTCGAGGCGCTCTTCGTAGACGGTCGTCAGCCAGCAACGCAGTTCCTG
CGCAAGTTTTGGCTCGATTTCAAGCAGAACGTCTGGGTGTCCGGCGTCGGCCCCACGCTCCAAAGCGTACGCGTCTGCGTGGCCGCCCTGTACCAGGAAG
TCATGGCGCACAAAATCACCGAGCTCATGCAGATCAGCGGACTAGACGAGAACTCGGCTGAGCTGCACGACGTGGTGTACGCAAAGGCCGTGGTGTTGAC
CGTGCAGCCTATTTATCTGAAAATCGTGTCCAAGGTCAAGCGCAACTTCGTCAAGGAGGACGCGCACGCAGCAGCACGCCTGCTACAGAGTACGCCAAAG
GTTGTCGTCGACACGAGCCTGCCGACCATGCCGTGGAGTAGTTGCAGCTGCACTTCTCCCGTCGAGTTGCTGGACCTCGTGTGCCAGTTGACGACGCTGC
CTCGTGCCAGCACCACCAGTGCAGCCACCGCTGCCGACCGACCACCAGCTCGCGGCGGTGGAGCTGCTGGGCGCTCTGCAGCATCAAGCGCGACACACCT
TCCTCGCCACGAACCCGGTGAGCAGCTTGTACCTCATGAAGCAGATCCTGGACCCCAAGTACCTTCCTCTCGCGCGACGACAAGCGCTCGAGGTCTTTGT
CGCGGCGGTCACGTGGCTGCGCAAGGAGCAGAAGCTCTCCTCGGACGAGGCGCCGTGAATCTTCCAGCGATTGCACGCGCATGTACCGGTACAGACAAGG
CCTGAACGGATGACAGCCTGGTGACGCCCGACGCCGACCGAATGAGTGCACGCACACGTTGTTTTATGGCAGCGCATGTTTCCTACAAGAGCCATCCATC
CCCACTGAATTTCGGAGAGATGGCCAGAATATATTATCTCGCGCTTGCCATCGTCCTCGTATCGTATCGTCCTCACCGTCTTGGCCCATTGCCCCGAGAG
TCAGGGCAATGTGCAATAAGCAAGTGAAGGTGTCAACGAACTTCCAGCAAAAAAGTATCTTTTGTAGCACTGCATAGCCGGGGCGGACGTCCTTTCGCCG
GCCAATAGAAGCGCCGATCTTGATGCGCGCCGATTTTACCCACTCATCTCGCTCGATGTCGCGATATTCCCATTGGCTGAAAACCCGCACAGTGGGCGCA
CAGTAAGCGTCAAAAGTTACGGCTCCATGTAGCGTGGTGTCGTCGCTCGCGACTTTCCTGGCGGAACGAGCGCGCACTCGTCCGCCAGCGCCCCATACAA
TTCCCTCCCTAGACCTTGGGCGCAAATACACCCCCCTCTGATACGCAGCCACTTCAGCACTGAAGACAGAACCCCCTCCCTCGATTTAATAACCCCTCGG
GTATGCGCGTGTGGACTCTGGCGCTCGGTCTGCTGCACGCCGCGTCGGCCGCCAGCTCCTCCGGCTCCGGCGCGAGCGGCACGCGCAACACGCTCACCAC
GAGCTGCAACGGCGGATGCAGCAACGCGTGCGTCGTGGTGGGGCAGTCGTCGGCCAACGCCATCGACTGCGTGAACGACACGAGCTGCGTGACGCTGTCC
TCGGGCCAGTCGGCGCTGTGTCTCGACGCCTTCGCCTCATCGGCCACCGAGTGGACGTTTCAACCGGCCGAGAGCAACGACACAGCAGGGGCCGGTCCCT
TTGAACGCGTGGGGCTGCTGCAGCTGGACGGCCAGGTGACAGACCTCACGTTCACCAAAGCAGAGCAGAATGAGGAACCGCTCTCGGGAACGCTCGAGCT
TTCGTCCATGAACATCCAATCGGATGCGACGCTGGACAAAGTGGCGTTCAGGAACTTGAGCTTGTCCGGTTTGGACAGCGCCTTACCGCTCAACAGCGTC
AGAAGAATGTGCGTCGCTGTGATGTTGCACGAGGAAGAAACTACCACGACTGACACTGGTATTTTATGTGGACAGATATTTCAACAACTGCTCCTTGAAC
GCCATCCCTACGGCTGCTGTGGCTGGAGACTCCGTCACTGTCATGTAAGAGCACATTCGATGCACTGCTTGCAGAACTTGTTCTAATTTTCATTGTTTGT
GGTGCAGTGATTTAGCAGGAAATGCCATCGCGGGGGTGGAGAGCGATTTCCAAGACGAGTCTTTCCCGAATCTTACTGTACTGTACGTGCCAACTTCTGC
TTTAACCTAGACTGCACCAACATTGCTAACTGAAACATGGTGTCTTTCGTGCAGTGATTTATCGGCGAACACTCTGACGGACTTCGACCTCGTGGTAGAC
AACTTTCCAGCGATCACGACCTTGTAAGTTCGCCTGCGGCGAAGTGTGCGCTGCTCGTAGCAAGCTTCCGACTCACCTTCCTGTATTCGTGTGCTTAGAT
TTCTCCACGACAACTCGCTGGCATCTGTTCCCGACGTGGTCTTCAATTTGTCCACACTCCAGCATCTGACGCTGGCCGACAACCCTATCAACGCGTCGGG
TCTTACAGTGGACCAGTTCGCATTCCTCGCGAATCTGAACGTGTTCACTATGATGGCACCACAAACACGAGCGCATGCCCAACCTCCGCTGTCCAGACCG
CGCTTAACGAGTCTTTCACGTTTTGTGCGGGGAATGGAGACGACATAGAACCCTCAAACGCGACAGTCACGGAGATGCCATCGACTACGGTGCCTTCAAC
AACTGAAGGTGCTTCATCTTCCTCTTCGTCGCACAAAACATGGATTATTATTGGGGCGTGTCTGGGTGGCGTTGGTGCTGCTTTGCTGATCTTCTTCATA
TGGTGGTGCTGCCGTCGGCGGAGGAACGAGCAACCCAAGCTATGAACAGTACAACTCCATCAATTGCAATCGGCATGGGCGACTTGTCTGACCACCCCTA
CATGGAATGGGTGTTCCTCGATCCACCAACGCCTCTAGCCAGACGACGTCGGACTTTGAATTATTGGCGTCTGTGGCAGACGGCTATATCGGACTTACTC
GGCTATCGTATGACGACGTATTCCTGCACAAGATGCTGCGTGTGAGCAGCCGTTCGGAGCTATGGCTGGGCGAGTACAAGCATGAGGTTGTGCTTGTCAA
GAAAATCAAGAGCAACACGGCATCAAAGGCGTTGATGCGGGACTTCGTGACAGAGATCGAGCTGATGTTCGAGCTGAAACACCCTCGCATTGCAGCCTTC
CGGGGTGCTATGTGGGATGCGGACGGCACGGAGCTCTGCGCTGTGGTCGAGTATGTTGAAAAGGGAGCGCTGCGTGATTGCACGGTTAACAATGCCATGG
AGCTGTCGGTGCCAAAGCAGCATACCATTGCTCGCCAGATTTCAGAGGCCATGGCTTTCCTTCACAAGCAGAACATTGTGCACGGCCGGCTGAATGCGTT
CAACATCCTTTTGGACAAGGAATATTCCGCCAAGCTTAGTCTGTTCAGCATTTTCCACTACGTGAAGCTTTCGCCTTTAGACAACGAGTGCAAGATCTTT
GCCGCCCCAGAAGTTCTGCGCGGTGAACAACCAACTGAGAGATCTGATGTATACGCATTCGGCGTGTGCTCGTGGAAATCGACACAGGTGAGACCCCAGT
GATGAATGCTCGGAGGCTATCGATGGAGCGATCGGGTCGCGAGGATGCTCTCTCTCCAACCGCCAAGAAGACTGGATTCCGCTTGAGCCGCCTCTGCTCC
GGCGTGATGAAGGAGATTATTGCAGCCTGTCTGGAAAAGGACCCTGCACGACGTCCATCAATGGCTGACGTGGCATTGGCTCTTAAGACTGGAGCGATGA
AGCTGTGAGGACTCGCTCAGCAACGAAGGCAGGCTCGACACAAGCCACTCTGGATTTTATTTTCTACTACATGTACCGGTACTAGCCTGGACACACGCCA
ATAGCGTAAAACGCTGCTGCATGAAGCAGAACTCGCGGTAGATGTAAGCCCGAACTCATGTAAATGGGAGGCAGCCTCCCTTATTTTTACCCGTCAGGAA
GCACAAGAAGAGCACTAGCCAGTTGTCGCTCTTTGTATAAAAACCACATAAAAACATTTAGGAAGCTGGTGGTTTTTGCTGTCACGGGGACAAAGCGAAC
AAGGTGAGTGTACGACAGCATCAAATTGGGAGCAACCAATGTTATGACTCATCTGATTGTCCAAACATATTGAAAGAATTCTCATGCCTGTCAAGTTGAC
AATCAAGTCAACCAGTCGATTCAGCCCTGGAGTCAAAGCCAGCGATGAATGGCATCCTTCGCTGGCGCCGCATCTGTTCCCGTGTTTCCAAGACACCGAA
AGCTTTCTCCCCGTCGTTTCGGGGGGTCGTGCTATTCATGTATGTACACGTCATTTCGATTTCCTCGCTAATCACATGCAAACACGTTAGCAGACATTGC
CGTGCCTCAAGCGATAATGCAACCAGTAGCACATTGCATGAAAAAATTGGATTGCCTTTTTCTACAAGCTCGAAGTGCGCCAAAGCTATCATTGTGCCAA
TAAATATTCAACGCGCCTCCCTACTCCTACTCCTCCAATTCGCCCACACAAAACGCAATCCAATGTGCGTGGAGCTGGTAGAAGTCTCCTATGATTTCCT
ATGTGCGCGCTCGGGTATGAGCGGCAATCACCATCATCGTTTCACAGATTTGGGCAAAGCGCCAGTGCTGGTGGCTTGATGCAAAGAGCACACATTACCA
TTGCGCTCGTAAGCAGGCTTGCGGCAGCCTTCCACAACACATCGCTTGCCTGTAAGAAAACAAGTGAGAAAGAGCAAAAATAAGCAGCAGCACGCAAAAG
CAACACAGCGAAAAGAGAGCTCTGTGTGTGAGTATAACACGATCAAGAACAAATTGCTTGAGTCAAAGTAGTCATGCAGCTCACCTCCTCCGTGAGCCCA
GCAAAGACCGTGGGAGACTGCCGTCTTGGTACAGTTTTGTTCGCTGCATTTGCGACCTGAAAAGGAAGCGGAATTCAAGTGAGTTTTGCATGACCTGTAC
GAATGAAAGGTAATCAATCAGCACTGCACCTCCGCCGTGAGACCAGCAGACGCCGCGAGACTTGGCACGGTTCTCGCACCCCGCCGGTGCATTTCGTCGA
GCCGCCTGCAATTGTTGCGCAAGGTTTGGTAAGCAAATCATGAAGCCACCTTTTTCAATAATCGTGCTTGCCTTACCGTGCTTCCAACACACACCCAAAT
TTTTAGCACTGCTCGTGCACCCCACGACTGCACATCGCTTACCGCCCTGTTATCAAATCAAGCATTCGGTCAACATTGGATCCAATGCGAACAGCGAAAC
ACCGCACAACTGCCACCCACCGTGACCGATGCAGAGTCCGCGGTTCACCACGTAGCGCGTGCAGTTTTCAAACTTGCAGATCCGCGACTTCTTGATCGCA
GCTTTGGCTGCTGCGGGCGCCGGCACATTGGCCTCTCGGTTCTCCGTCGCCGATTCGTCCCGAGGGGCCCCTGAACTAACCGCGAGGTCCGCTGCAACGC
ACCAATGCAGCAAACACCGACAAGTCACGCTCTGCAAATCCAGTCGGTCGTCCGCAAGGTTGCAAGGATCAGCGCAACGTACCGAAGCTCGACGTTTGGT
CCTCGTCCGAGCCGCCGAGGATGAAGGCGAGCGAGCTCTTGCTGGCCGCGGCCGTCGCGTCCGTGTTCATGATGGCCTCGAGGCGGTGGCGGTTGGCGGC
GACCTGGAGCTGCTGCAGCGCCGGCAGCGAGGGCCCTTCTCGCACGCCGTGCCCATCCTGGCGGGGCTCGTTGGTCGCCACTTGGTGGAGCCACGCTGCG
CTCATGTCGACGTCGTCGCCGGCCGAGTTCTTCATGCAGGAGGCCGGATACAGCAGCATCCAGAGGGGGCAAAGTCTTGAGATAGGGACCAAAGGGGTGT
GGTGGTATTTTATTCTAGTGCTGCCTGCTGCTGGCAGAGTCAACTGTTCCAGCAGTCAGCCGGTTGTTATCTGAATAATGGACTGCAAGAAGCAGTCGAT
TCAAGTCGACGCCTGCCCCGGCTGGCGAGAGAAAAGCCCCGAGCGCGGGCCGATGGTGCGTTGATTGCTGTGGCCGCGTCACTGGAGACTCGAACCACTG
GTGTCCGACAGGCTCCGCTATTGATGCCGGCTCCGGCTTGCGAGCACTTGCCCTTTGTATGTCGCGCGGCGAGGCCAACGGATGGTGGCCAAAATTGGCC
CCATTTCGACCAATCCAAAGTGGGTACACAGCGCCGCTTCGAGCTTCGAAATCCCGCCCCATACTGGGGCCAAGCTGTTTTCTCCCAAGATCGCGCGGCT
CGTCTCT