Description :
From Genome Similarity Track
Location :
contig_100:13321- 14721
Transcript NameFunction/comments
g13487.t1hypothetical protein

Sequence
1400 bases(100 bases per row)
AGGTCCCAATCCATCCATCCGCGCCCATCGCCCAATCACCTGGTCGGAAATGATCAATCCATCACCAACCCTCTGATCACTTCTCCACATACACTCTCGT
ATTGTACGACTTCTATCTTTCAAAACAATCCTGGATTCCTTTACAACACACTGCGGGGTCTGCTACATGTATCAGGCCTTGAACTAGCATTACTTTCATT
GACGTATAACTGGGCAGCAGCTCCGGTGACTTCACCATTTGCGTACATCAGACCATTTTCGCAGCGTTAACATTGTTTCCAGGTCCCACCAAACAGTTCA
CCAATTAGTACAGCAATGAATACCCGATGATTATCACGGCTGTTGGCTTGTGTCGAGTCGTCAGTCAAGTCAGCAATGGGTTCTCCATTAGCTAGGTTAT
GGCAAATGTAGGCGTTGTTTCTTGTAATGTCTATCCTTGCCATTGCTAACTTTTTGTGCCATTTTTTGAATAAATTCCCGCCCGCGATAAATAATCGACT
TCGAGTTGATCATGACGATCAACCCTCTGTATGGCAATGTTATATTTGCGCATGCAGACCGGAGCCTAAAATCCCACTCGTTTTTGCGCGATTCTACGTA
ATACCGCTATAGTACCCGATTCGTCGGCATTAGACACAACGTTTACGATGGACCCGTCCACTTAACTTGCAGCAACGATATGTTTCTCTCCCCAAATGCC
TTGATTCATACCCCCTCGCTCTTCGTCTAATTTCGGGTCTAGCATAGTGAAGTGAGGGAAATGGTTACTGGCTGATCTAACTGTGCTGCGGTCATGCAAA
CCCACAGATCGTAAGCTCTCAATGAGGAGACAATATTTATAAAAAAATGTCCGTATTGACAAATCGACGTGACTCTTGCAGCGTGTTTGTCACTTCCAGC
ACATGACGTCGGATATCAGACGACTTCTTCGTGATATCGGCAAGACGGTCAATCTGGGAGGTCTCAATCATACCTCCCAATATATCGTGAAGTTCACTAG
CGCAATGAAGCTTAAAATTCACTACGAGCCAGGTAGTGGAGCAACAGCACATACAGCGTTTGAAGTGGTATTATCCGGGTTATAAATGATATGTCTCGCG
TACTTTGAGCGGGATACGATACTGACCTCATCGACTGCTACATTCCGACCCACAACAACATTGCGCGTTCAGCGTGATTTTAGCATGGTACGCAGCGGGC
GGATCCTTGCAGCAGGACCACGCTGAACTTCAGCAATCGTCACTTCCGAGCGAAATGCCAAATTCTTTCGAATATACAAGAATCGATGCCACGCCATGAT
TGAGTCCAAGTTAGCGAATAAAGCACCAGGAAATATTCTTGCTTCCTCATTGTCTCCCCAGTAGTTTATCATTTCGCCTGTGCCCACTAGAGCCATGTGC