Description :
From Genome Similarity Track
Location :
Scaffold_1056:1332- 3595
Sequence
2263 bases(100 bases per row)
TAGTGTTGGTAGTGATAACTGGATAATACATTGGCCAGATCCTACAACCTAGTGAGCTTTTCCTTTACTTGTGCAGATCCGACAGGTTAAAACCGAATTT
ACTACTTGGTCGGTTACACCCTAGGGGCTCTCAACTCTCAAGATCCCGTCACAGGAGGCGGCAAGTACAACGCAAAGGAACGCAAAGGCAAGGGACACAC
CCGCAATGCAACCCTACGGCCAGATCCACGATCTAGGCCCCGGATCCATAAGCTCGAATATTCGCTTAGTATTCGGAACCATCCACGGACGCAGAGTGAA
GATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGCCAAGACGCTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAGATCCCGCC
CTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGGTAAGTTGGAT
CTGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACATTTAGCTCAGTGGGAAAACAAGTCAAGATCAGACGGAAATCTTTGTTTAGAAGGTTTCTT
CCGAGGATGAAATATTGCACATTGTCTCGTATCATCTTAGGTATTTGAAAGAAGCTTTGACCGATGTACAGCATTGAGAAGCCTAACTTGCGCCCCTTTA
TGAAATACTGTTTCGCTTGAACGTTTGCTTGATGATCTAAAATCAGATCGTCGAAGATAATGAAGCGCTGGTACTTGTCTATCCGCTTGAGCTTGTTGCG
CTCCTCATCCTTGATGCTGTAGTTAGTGGTCGGAGGCACCGCTCTGTCTTAAAAAAACAGCACAGACTTGTTGCCGAGCTTGTCGAAGAGGTGATCGTAC
AGCGGCTCGTCTCGTGACTTGACGCACACGATGATCTCGTGGAACGTCTTGTTCATAGCGACAATCAGGTTCAACAGCGCGTTGGTCTTCCCCGAGCCAC
TTGGAGCTGCCGCCAGCGCGCGGAATGGCACGTCGATCCCGTGGATACCTACATTTGGGTTTATCACATGCTCCCTTTTCGTGTATTGATAGAAGTTGAT
CATCTCTCTATATGGCGGTACAGATATATCCGCTTTCATATAAGGATGGCATCGTACCCCGCCATTCGTCCCACCGATGTGCTCAATACATCACTGTTCA
CCAAAAGCACAGATGGTCTGACTTTAGCGAATGCAGATCAGCGCTACATCCGCTCTGGATCGACAGCAACTGTCTTGAGTCTTAGCTGTTCGGGCTTGGC
TGACGTCGGCTCTCTCAAGATCGGTGGAGCTACTGTCGACCTTACGCCAATCTCAGGCGTAACAGCAGGAACAGCTCTCGGAGGGAAGGCGCTTATTGTC
GACAGCTCACGCAACATAGCGAATCTAAACAATGTCACTTGCTCGGGCCTTGCAGATGTCGGCTCTCTCAAGATCGGCGGAACGGCAGTCGACTTGTCAC
CAATTTCAGGTGTCACAGCTGGAGTAGCTGCCTCGAGCAAGGCTCTCATTGTTGACAGCTCTCGCAACATAGCGAATCTAAACAGGATCACGCTTGGCAA
TACGAGTAACAACGCGTCCATCGACTGTGGTATCATCTCACCGTCAATGAAGTGGAGTATAACGGACTCCTTCTGGGTCTGGATTTGCAAAAGGGACAAG
CTCCAAAACGGCTGGTGATTTGTGGGGATTCAAATTTGGTAATCAGACAGGTGCGAGGTGAGATTGACTGCAAGGCCCCGGCCCTAACACTGTTACGGCA
GAAAGTGATGATCCACCTGCGTGGTTGGATGAATCACGAGTTGGTGCATGTCAAGCGAGATTGGAATGCCAGTGCGGATAGCTTGGCCAGTGCCGCTTTA
CGGAATCAATGCGGCGTTGAAGTGGAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAATCGACTAGACGAAGTGGTGGTAGTCGGATCCGGGAAAA
GGACAGTCCAGGTGATTGCCGTCACTAGGTCCAGAGGAAGGATTGGGATCCAGCCCCCAGATCCTCGAGGAAACATTTGTGAAGAGAGTCCGCATTGAGC
GGATCCTCAAAGCACTGAACGAGGAAGCGTGGATCCTGGGATTAAAGAAGTATCTGATGGGGGATGTACGAGACTTAAGTCGGGAGGATGCCAAATCCTA
CAGCATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTTTTCTATTGCCCCCCCCC