Description :
From Genome Similarity Track
Location :
Scaffold_2224:1332- 3263
Sequence
1931 bases(100 bases per row)
GCGGGTGATGATGGTGATGCGGTGGTGAGCAAGGCGGCGGTCCGCAGCCCGGtcctggaggaggagggggGCCTTCGAAGAAAAGTGGGGGTGGAGGACC
GccatggtggtgatgatgggGAGGCAAGAACGGCTCGGGCGGCGGGGCATACACTGGCGGAGGGCATCCCGGTCCGGGACCATATCCGTACGGCGGCGGT
CCTGGGGGCGGGTACTCCatcggaggtggtggcggcgagtGTCTTCCTCGTGGCGATCCAGGGTATCCGCGATACatggtgctgcgtctgctgtcTTGAA
GTCTTGTGCACTCGGTCCGGCAAAATGCGTTGTGAAGTTTACATACACGTACGTAGCTGATTGCCAGGCGAAAATGATGCAGCGGGAGCGCACGCtgtcg
cagcagcagcagcagcaaaagcgcGATTGATCATGCGACGTTGGCtcggagctgcgcaagagTGATAATCCAGGCCTGACTCGCCTCTGTACAAAACCTG
ATCTAGACCTGATCTACGCTTCAACAGCACTCAACAACGCTGCCACGCTGGTCTCCGTTGGCGCTTGGAGGCGTAAATCCTTGTCGCGAAATGGAAACCA
CAGCTGGTAAATGACGAACGCTACATGTACGAAGTGTGCTGGTGCAGATGACGTATATTTTACGATAGCAAAGCGGTGCTCGAGATCTCTCTCAAGCTCG
ACGCATTTGCcggttttttttttttgggggggggggtatCTGTTTTTTTGTTTGTCTGCTGCACGGACGACTGACGGCACTGTCGGTCGCGGTAGTCCTT
ACCAGCCgcgcggaggaggagggccGCGGTGGTCCGGCGGCGGTGGGCTGTGGTGGTGCGGCGGGGgtccgtggtggtggtgctcggGCGGCGGGggttg
atggtggtggtgatcaGGCGGAGGCGGGCTGTGACGTCCTTGGGGGGGggcatggtggtggtgcggaGGGCTGTGCGGGGGCGAGTGCGGACGGCCGAAC
ATGGCGTTCCCtagctgttgctggcttATCGAGTCTTGGAGGCGGggcaaattgaggaatgagtCCTGGCCTCGTGGCAacggtggcgtcgtcgacaaTT
GATCGAATTAGTTTGATTCACAAGGCACGGGTTTGTGCTTTGTGAATCACCTGCAACACGGACGATAATCGTGTCACACCAGACGTGAGCTGTATCCAGG
ATCCGCAAGCGAAATCTTCGCCCGAGTATCCAGGGCTAGATTAtgaccccccccccccccccccttcACACACACACGATCGTTGCAGCATAGCGGCACT
GGCAGCACGCTGCGAGCTGGGCTTAACTAGCGGAACCCCTGCCAAGGAGGTTGTTTATTTTGCCATTATCGCACTGAACGCTGGTAAATGACCTGCAGCC
ATCGGTCTTGCGTTTGTGGCGTGCACCTGCAGGCTGAAACACAAAGCAACGAGTACTGTAGCCGCTCGGCAGCTTGGTGGGGAATTGTCTTTCAGCCTGA
AAGCAGAGGCGTCATGCCATGGCCGCAAACCTGAGTCAAGCAGGGTCATCACCGCAGAACAACTAAAAGGCGTTGAAGCTCGCGTTTCGGTGCTAGACTC
GGCTAGAGACGCGATGCTTCCGACTTGCATCACGGCCGCACCACAACTTGTGGGCGTCGCTCACTGAGCGGCCACGACCGACAGACTCGGAGTTACCGGA
AGCTTGTCGCTTGGTGCGTCGTGATCGTGCACTGGCGAAGGTCCTCTACGAGATGACTCCCACACCACGGCGTATTCCAGGTGGTCACAAATAACAAGCG
CATCTAGCACAGTACAAACAAGGTCTCGCCAACGGCAACGTGGGctagaaaaaaaaaagtacCCACGCTGTTTGTTCATGAACTTGCCAAGCCCGACAAC
GTAGGTAAACAAATCGTGGTCGTGCACTCGG