Description :
From Genome Similarity Track
Location :
Scaffold_1834:1332- 2635
Sequence
1303 bases(100 bases per row)
TCGACTTCATACTGGTTCGTACTTGTGTCTGGCTCCCAGCTGTCTTCAGGCAGTAATTCTTCGTCAAAGTCAAATCGCTGAGTCTCTTCGAGGTCGGCGA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCTACCTTCTTCATCACCCTGAATGGCCCATGCCATCGGTGAGCTAACTTCTTGGTCAGGCCCGACTTGACTCGCTCCATA
ACCAACCAGACTTGATCTCCTTTTTTGAACAAGGATTTGATGGATTCATCGCCTGGTTCTGCAGCTCCATCTTCGTCATCTGCTGTGTTGGGGATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTGTCCACGTCGTATTGAGCTCGTCATAGCCTTGAGTGTAGACTTG
GCGTTCCAGCCATGTACGAGATAGAAAGGGGTTTCTCGCCGAGTCGAGTCTCTTGAGTTGTTGATAGCGTGTACCATCTTCTCGGCGATGTCATCCCAGT
CGGCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAACCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACTTTTGGAATACTTCACTCATAAACCTTGGATCTCGGTCGTGCCGTATGAGAGACGGAGCCCCGAAC
TGCCTGAAGATGCATTCCTCAAATACCTTGGCCACTTCGAGTGCCCCGGTGTCATTCATAGCCTTAGCGATAACGAACCCCATGAAGTGGTCCTGGAACA
GCAGTAGTGCAGTGTTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTGACACCACATTTCCCGGCGA
GTAACCTCTCAACTGCGGCTTGCTCTTACTGGTATTGGGGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTAGTAGTCG
GCCTTGACTCGGTGATAAGCTCTGCCGATGCCTTGATGCCCTCCTTCGATCGAGTTGTGACCGTTATGAAGTATTTCGCCGACCATAGTTGACGGAATCA
CCA