Description :
From Genome Similarity Track
Location :
Scaffold_216:1332- 2380
Transcript NameFunction/comments
Phypl_g5415hypothetical protein

Sequence
1048 bases(100 bases per row)
GATCCCCGAGTGGTTTCAGACACGGGTATCCCGAGTGGATCCGAGAATGGTGTGCGGAATGGCCGAAGATCTTCAACACCTTCTAGCTACGGAGCTACTC
GAATGGCGCGAAGTCACTTCGGGTGTTCCATCTCGGATCGTGCCAGTCGTGGATGCACAAGCCCTGGAAAACGCTGCCAGGAACGATAGGGCAGGAGACT
TGAAGGCGGAAGATCGAGATGGAGATTTATTGATGTCGCTGGAATAATCGGTCGCGACTACGTGTTGCGCCTGAGGGTGGCTGGGATCCGGACGACTCGC
AGTCCTGCGAATTCGCCCCTTGGTGAACCTGAGTCGAAACACCCACACTTGCCTCCCCCGTCGGTGCTGTCCCTGAGTTCGCACCTGTCATACCGGTCGT
CCACTCAAGCGAGCCATGGGACGGCCATCCCAAGTGGCAGGACATCTCTCGGCCGGAGTGTGTCGTCACGACGGAGTTCGAGCTTATTCGGGACTACCGC
TGGTGGATCGGATGAGTCAAACCTCAGTGTAGCCTCGGGATCGAGGTTATCCGCGAGgaactcgtcctcctcgtcctcaaTGTGGTCCTTTGGAGGAGCA
GCGTCAAGTCACATGCCGTATGCCGGGCCAACCGGGATGGTATTTGCTGCCCAAGGTGGTGAGAATCAAGATGCTGGAAGCATGGGTGTCCAAGTCACGG
AGACAATACTCCCAGCGCCACCAGTGTTGGTAGACCAGGACAATGTCGTTATGTCGGAGTCGGGTCGTACCAGCACTCGGAGTGGCCGCCGGTCGAGGAC
GTCCCGTAGGCACATCCGATCCAGAAAGTCAAGTCCGGACCGATCGCCTAGGATTCGAGAGCTGACAAGGGTGAtcgaagaagccgacgaagtTCCAGGC
GTCACAGTCGATCGTCTAAGTGCTTGTCCAAGCCTAAGTGGTCGCCAAGACCGTCGATTAAGTCGGAGCGCACGGGTCACTCAGGAAAGTCCGGTCGATC
GGGAATGTCGGGTGCATCTCAGGTTGCGTTGGAAACGATGAGGTCGAC