Description :
From Genome Similarity Track
Location :
Scaffold_16:133181- 145115
Transcript NameFunction/comments
Phyra_94365Hypothetical protein
Phyra_76085lipin-like protein
Phyra_71387malate synthase
Phyra_76087protein kinase

Sequence
11934 bases(100 bases per row)
TAACCATTGTAGTCATCGTTCGTCGATACTGAAATATCATTTTGGGGCTTTGGAGTCGCTTCGAGGCTCTTTGTATCCAGCAAGCTCTGTAGCCGGGCTG
CAACAAATACCATACGGGCTTCATTTTCAATACTTGCAACTTGACTGTGGTGTAGAGCTTCCACTTGATTTTTTAAAGCTTTCAATCTTTACCGAGGGGA
AACAGTATCAGTGAAGGATTGAATCGAAAAGAGCAAGCAAACTGAGAACGCATGGGTTTACCTTATTTGTGTGACGCCATGAGCTTGTGAAGAATTCGAG
AGCATTTGGCGCAGCGTTTCACACGTGATGGGGTCTTGTAGTAGTGTTTCGAGTAGCTCTACAAAGTCACATGCTACATCATCTGTAGCCGTTGTCGACA
ATCCATTCTCTGCGATCTCCCAAACATTACGCGAGCACAATGTTTGCTTCACGGGTGGATGCATGACCATACTATTGGTTTGGCAAACACATCCGCACAG
CATGTATTAGAAAAGTGAAACAATATACCGTCAAAGAAAAGAAAACTGACCTGTTCAGTACCGCAACACCATTTGCTTGCACGAGTTCAACGCTCTGCAG
CCCACGCATTGCATCTAGGACGGCATTCACCACACTTTGAAAAACGGCAGTAGTAGCAGTTCGAGACGGAACACTTTGGACCGCAACATCTCGGTACTCA
AGCTCCACACAGAGGAAAAATAGCACATCCAACGCTGTCACTACGAATTCGGCTTCCTCCACAAAAACGGACAAAGCGCTCGTGACCGTCTGAAGCCCTC
CATGCCTCAAAATGCGCTCTTTACTGTCCTCTTCAAGCGCCATCTGATGGAGAAATTGGCACGCTCGAAGCTGCACAGCAAACACAGTCGCATGTTTCTG
CATGACCGAGATACACAGCCGTATCGTATGTGAGACCTGCAAACTCGGTCGGTTCTTACTATCCGTCGCTAGTGACTGGAGCGTCTGCAGAGCTGCCGCC
GCCTCAAAAGCCGACAGTGTGGAAACTTGCTGATCGGATTCCCCACAGCGAACGATCAAGTCCGCGACGCCGTCACGGACGAGAGCTTCACGCTCTTGCT
CCCCACGACTGCTCACTTTTAATAGGACGCGGTTGACGCACACGAACACCGTCATGAAGCTGTCGTCGCTGCCGTCGCCTGCCGCGGTTGGCAATGCCCA
ATAGCTCGCGTCACTCAGCACGGACCGAACACATGCCAGCGTCTTGGTGAATGTTCCGTCGCCCACACTCAACTCCTGCGGCTTCAAGGACGTCAACAGC
ACCTCCAGCGCTCGCCACAGCGCCCGCGCTTCAGTCACCCGCTCATTTCTGCGCGGGTCGTCGTCTTCATTCGCGAGCTCCCACAACCGATCCAGCAGCG
CGTCCATCGCGTCGTCGAGAAGATCAGATAGTGCACAAACCCGCACAGGTATTTCTGCCCTCCTTTATTTTCGGCAACGGCTCACTTCAACTTGTACCAG
TCAAGAGCACGCAATGTACCACGTATGCGACATCTCTCAAGACAGCTCTCCCAGTTCCCCATTACGCCACCAGTTTAGCTAGCAGTGCGGTGGCCCCTGC
CTCATACATAATGGACTCGACAGTGCACGCGACGCCTTCCCTGCCTCCGCCAATGAAGGCTGCGTCCACGAGCGACATGGACGATCACGAGGCCATGAGT
CTGTTCGGGGGTCCTGCAATTACGGCGCCTCCCCCCGCGCCGGTTAAATCCGTTTCCACTGGAGCCATCGCGGACGACCACGGGAGCTACGACCTGTTCG
GCTGCAGCGTCCCGATGGCGACCCCAGTGACGAAGGAAGCTGCGCCCATGGCAAGCACCGCGCCTGTGGAAGATGGGGGCGTCGGGGAGGTGCGCGAGCC
TCTTTCTCCAGCAAATTACGAGCTTTTCCCGGCGTTGGCGTCGACCGAGAAGCTGCAAGATACTGGGACAACAGAGGGTGATTCGGAGCTATTCCCGTCC
TCGAGGGGACTCAGTGGCAGCAGCAGCAGCAGCAGCAGTGCTACGTCTACGATGAGCGGTGGAGGATCGTTCCGTGGAGAACCCCCGCGTGCCAACAGTA
ACGCGCTACAGGTCGTGTCGTCTGGGGACCAACAGAGCTCCCCGCCGACGTACAAGATGGCGGGCAACGCAGTGGATATTGTGGCGGTGAAGAACATGGA
CGGACAGTACCTTACCACGTCGTGGCACGTGTCTTTCTCGTGGTCGCGGTTTCGATCGAGCTATGTGACGGGTGTGGGAGATATGGTGAGGATCCTGGTC
AATGGCAAGGAACTGCCCACGAAGATGGAGCTGCAGGAACGCGGTCGGTGCGTGTTCATTACGGGTGGAATTATGATCCCACCGGGCGACCTCCTCTTTG
CTGATTTGTCGGACGACCACCCCAACCACGTGCGCTTCGAGCACTTCCAGAAGTACACCAACACCGTACGCTATGTAGACGCCAAGCTGCATCTGTGGGG
GCCCAACGAATCAGTTGTTGTGGTCGACTTGGACGGTACGCTTACTATTAGTGACGTGGAAGGCCATATCCGCACACTGCGTCTCGGTCAGTACGATTTC
CTGCATGCTGGAGCTTGCGACTTCTTCACCAAGTTGCACGAGCTGGGGATGCGAATCGTGTACCTCACTGCGCGTCCACTCGACTGGGCATCCGCATCAC
GTACACACTTGGAGAACGCAGTACAGAATTCGTGCCCACTTCCGCCAGGAGTTCTCATCACGAACTCGACTGGTCTCACTGGCGCGCTGTTCACAGAGGT
CGTGAACAAGACGCCGCACGTTTTCAAGATCCAGGTGTTGAATGAGCTGCAGCTTACGCTCATTCACGCTGGCCGTGTGATCGAACAACCCGTCTTCGTC
GCTGGCTTCGGCAACCGCCCCACCGACATCGTGGCCTACGAGGAGGTGGGCATGGATCCCAGCCTCATATTCATGCTAGACCCGTATTCCAACCTCAAGG
CTGTAACTGACCCGCGTCTGTACGAGTCCTACAACGACCCGAACGCGCTGCTGTGGATGCTGCCCAAGCTCAAGCACCGCGTGCCCATAGAAAAGGTTGG
TCGTATCGACGACTACACTGTGCGAGAACTCGTTCTAGCCGAAGACCGTGAGCAGCTTCGCATGGCCGAGATGCAGGCTCGTCGACTGCAGCAGGAGGAG
TTCGAGCGTGCCCGTCAAGAAGCGGACCAAGCTCGATACGCTGCGTCCAACGTTCTCCGCGCCAGCAGCAGGAGTCTCTCCAGGTAAAAACACAGCAAAA
TGGCCAACCATCTCGATTGTATGACTACGTACAACAGCAACCAGTAACTTTCATGCAGACACCACCAAAATGCAATGGTGCAATCATAACAACACACCAT
ACAAAAGGAAATCAATCGCCACGATGTCATCTGTTCGTCTGTTGTCGCGCGCTCCATGGGCTCTAAAGGCCCCCGCACAATGCCGGCAAGTCAACTCTCG
ATCTGCTGCACAGCATCAGCGTCAGTATGAGTTGCTGGTGCCTGGGCTGCAGGCTTTCCGGCGTCGTAACGGCCACTGCGCCGTCCCGTTGCGCTTTACA
ATCCCCAGCAGCCACGATGCAGACGCTCCGCAATGGCCTCAAGAAGTGCAGGGAATGAAGCTCGGCACGGCCATCTCCCGGTTTCTAAAAGCCTGTGCGT
CGGCCAAGAAGCCGTCGCGACGTCGGGCTTTGGACCATGTGAAATCGCAACTTTTGGCGGTCCTGGGGCTGGCGAACATCGAGGACTGGAAGCGCTTCCT
CTGGGAGGAAGTGACGGTGCCAGCCATGCAGACATACAGCACCGAGTATGGCGATCTGTTGGTGCCAGTGTCGTTCACGGTACCGCATGGAGATGGCTCG
TGGCCGGTGTCAACGTGGGGATACAAGTTGGGTTACTGGGTAAGCGAGCTACGACGCAGCAAGGACAAGCTGCTGCAGTATCAACTGGAAGACTTGGAGG
CGCTGGAATTCAGCTGGAATGCTCGTGAAGCTCGGTGGAATCGCTTTTTTATTCCTGCCATGCAGAGATACCAAGAACTTCATGGCAGTGCACAAGTACC
GCAGAGCTTCGTGGTGCCGAGTGACGATCCAGAGTGGGCGGCGGAGTTGAGGGGGTATCGATTGGGACAGAAGGTGAACAACTTGCGCTGCGGAGACCCG
CTTGGCACAGGGCCCAATGCAGAGGAGTGGCAAGACGTGGAGCTCATTTACAAGAACTGGATGCTACTGGAGACGCTGCACGAAGTTGAAGGCAGTGGCG
TCCTGGATGAAGAAGTGCTGTCAGATCAAGACAAACCAGAAAAATAAAGCAGCAAACCGGCACAGCTCTTGATCATCAAGGTTTTCGTGCATTGAATTAT
AAAATATCGTAACGACACTTGCCCTTAAGTCTTCCGCAACTGGTGCGTAAACACGTCGGCACTCAACCATCATGTCATCGCCAAGAAGTCCCACCGCTCA
ACACTCCTACCATTCGGATCGCTCATTCAAATCGTCCTTGGCTTGACAGGATGTTATCTGCAGCGATGGGACTTTAGCTTCAGATGCTGGAGCCGAGCTG
CACAATGCGCGGGTAGCACGGCAGCGTGAGGAAGTCCACCATGTCGTCGCCAGTCAGCACCTTACCCATGATCTCGCCACCGAGCGCCCACTTGTTCCCA
GGGGTGGCCTTCAGCGAGCGCTTGTTAACACACTCCTTGAGGATGTCCAGCACCAGATCCTTGGTCACCGTCTTACCCTCCACGGTCTTGCAGCTGTGGC
GGATCCACTGCCACACCTGGGCACGCGAGATCTCGGCCGTAGCGGCGTCCTCCATCTTGTTGTGGAGTGGAATGCAGCCGCTGCCACGCAGCCACGCCTC
CGTGTACACGAGGGAGACATCAATGTTCTCTACCAGGCCGTTGTATGTAATGGGGCCAGTCGGGGGCTCAATGAGCTGAGCAGCAGTGATGTCCTTGCCA
GCCTCGGGAATGAACGAGATCTGGTTCGGGCCCGACATCTTGCTGAAAGCATCCATGGCGATCTTGACAAGGCCAGGGTGTGCCACCCACGTGCCGTCGT
GGCCCGCAGCAACCTCACGTGACTTGTCCTCAGTAACAGCAGCCATGAACTTGTTGTTAAGCTCCGGGTCGTTCTTGACAGGAATCTGAGCAGCCATGCC
GCCCATAGCGTGGGCACCACGACGGTGGCACGTGCGCACGAGCAGCTTCACGTAGGAAGCCATGAAGGGCGTGGTCATACCAACTGACGAACGGTCAGGA
ACCACAAACTTGGCGTGGTTACGGAACTTCTTGATGTACGAGAAGATGTAGTCCCAGCGGCCGCAGTTGAGCCCGGACGAGTGGTTGCGCAGCTCGTACA
GGATCTCGTCCATCTGGAAGACAGCCACGATGGTCTCCACGAGCACCGTCGCACGGACAGAGCCCTGGGGAATGTTCAGGTAGCCCTGAGCAGCCACGAA
CACGTCGTTCCACAACTTGGCCTCCAGGTGGTGCTCAAGCTTGGGCAGGTAGTAGTACGGGCCCGAGCCTCGCGCTAGCAGTTCGTGGGCGTTGTGGAAG
AAGTACAGGCCGAAGTCGAAGAGCGAGCCCGACATGATCTGGTTGTTCACGAGCACATGGGCTTCGTCCAGGTGCCAGCCACGCGGGCGCACCAACAGCG
TGGCGATCTTGTCGTTGAGTGCGTACTTCTTCCCGGTTTGCGGGTGGGTATACGAGATGGTCTTGCGCGCGGCGTCGATGAGGTTCACCTGGCCGTCCAC
CTGGTTGAACCACGTGGGGGCCGTCGAGTCCTCGAAGTCGGCCATGTAGCACTTCGAGCCCGAGTTGAGCGCGTTAATCACCATTTTGCGGTCCACGGGG
CCCGTGATCTCGACACGACGGTCGGCGAGGTCGGCGGGGATGGGGGCCACCTTCCAGTCGCCCTCGCGGATGTACCGGGTCTCGGGCAAGAAGTCGGGCA
ACACGCCAGCGTCGAGCTCCTTCTGGCGCTGCACGCGCGCGGCTAACAGCGCCTGGCGCCGCGGCTCGAACTGCTCATGCAGGAAGGCGAGGAAGCGCAG
CGCGTCCGGGGTCAGCACGCGGCGGAAGTCGTCCGAGACGTGGCCCAGCACGCGAACGTTGGCGGCGTTGACGTTGAGCTCCGACATGGCGGTTGGTTTC
TGTTTGAGACTGCTGGAGATGGTCGATGTGTCCCTCGGAGGCAAATTGCGGAATGGCTTCCAGGAGCGATCCTGAGGCGACGTCTGAGCCGATGCCGACG
TGAAGACGCAATGTCTTCAACGTGCAGTTTTGGCCAATGAGGTCGCGTCGTTTCCTGCTAGGTCCACCATACAAAAGCCAAGTCAAACGACGAGGGACCA
TCACTCTTCCTTGCGTCTTGTTAAAACTGAAGTTGACGTGTCTTGCATTTCGTGCGATGCAGCAGCAGGTTTTGCCGGGTGTGATCAAGTTGATTGGACG
GGTACTTTCTCTGCATGGGCCGGTGCATGGGAAGTTCCCATTGGAGGCACCTCGTCCTCGATCGCGAAGTGACGCCGCCGTGTCCTCGGCATTGAATGCT
ATAATAGTCTTGTGCCTTCAGGAACGAACTCGTGGATGTGCTTGTACCGCCAGACCATTTCGGTTGTACGGTGCGGATGGTGCGCTGCAACTTCAACGTG
TTTGTCCAAGTACATCGCACAACCGCTTGCGTCAAGAACAAACGTTTTTGGTTATCAATTGCGTTGAAGGGGCCTGGCAGTCCAGCTATCTCAGAAGAAT
CTCCATCTTCTGTCGATAAAAGCGTTTTACGAGTGCGGTACAACTGAATGCCCGATGCCATTACCAAAATGTTTCCTTGGCGAAGGGGCCTTGTATTCAT
CAACTGTTCACCGAGCAAAAAAACATTAAGCTTTATGCGGCAGTGTGCAGAAAGCAACACCAGGAGATGTTGCTGGACATCCACCAAAGTGGGCGTCCAT
ATGGAAAAAAAATTGGCGACCCCATTTTTTTCAAGTGTTGATACCCACGTTTCGCCTTGCATTTCATAGGGTTTCAAGTGCAGGCGGCGCCAGATGCCTC
TTTAAAACTTCAACGAGTTTCCTAATCGTTGCGTCTAAACTAACTAAATCACGCCGGAGGTGAGCCCATAATTTCTCTTGGCTGACGGCGTCTTCGGCCT
CGTTGAGAGGTGACGCTGTACTGCGGTCGCCTCCGAGAAGCTTTTGGAGAGGTCGATCGCCAGTCCCAGTGGCACGACATTCTTGGCCTCTTCGATGAGG
AAAATCACGGTGCTGAAAGACGGCCGCTGGATCGGGTCGGGGTCCCAGCACGCCTTCATGATTCGGTGCAGGATCTCTGGGATGTGTGGCAAAAGCTCGG
GGCGTAGATCCTCGTGTGCAACGAGGTAAGCGAGGTTGATGGCGTCCTTGTCCAGGTATGGCTTCTTAAAGCAGAAGAGTTCCCTTGTGGCACGACACAT
TTCATTAGAATGAAGATCGTATCACAGAGGTGACTGCAGATTCTGTGTACCATAGCACGATGCCGTAGGAGTAGACGTCGATCTTTTCCGAATAGTCCTC
CCCGCGAAATACTTCCGGTGCCAACCACCGAGGAGTGCCGCACATAGTCTGCGCGTTGGTGTTCTTGTCGAGGCTGCGTGAAAGGCCAAAGTCGCTCAGC
TTGCACCGGAAGTCTTCCGTGATCAGTAGATTTTCTCCCTACGAAGACAAACGAGAACCAAAGTTATAGCCAATATTCAGCCAGCAAATGCAACCGTGTT
TTACCTTGATATCGCGGTGAAGCACGGCTGGACTAAGCGCGTGAAGATAGGCACACGCTTTCGCACAGTCCATCGCAATTTCGAGTGTGAGACCCCATGT
GATGTTGAGCTGCTTGCTCCGAGCGAGCTGTAGCAGGTCGGCCAGAGATCCAGCGCATAGCTCTGTGAGGAGACAAAGCGTGGGTGGCTCGAGCACTGCA
CCTAGGAACATCACGATGTTGGGGTGCTGCAGAATGGAGAGAATGGACAGCTCGTTCTTAAAGTCCTGAACGGTTTTGGCAGAGTATCGCTGGGCAAGTA
ATCGTTTGAGAGCGACGTGTTTGCCTTTGTAGAACGCCTTGTACACTACACCAAACGTCCCCGTGCCAATCTGACTCTCGATCTCGATCTCATCGAAAGG
AATCTTGAGTCCAAAGAAGACCGAGTTGTCGATGCGTCTCGAGTCTGTGATCGGGTTCACGCGGTGCTTCTTCTTCGACAATGCAACGTAAACGAGGGTG
CCAGCTTGTGTGGTTGACTGGAAGTGGTGCGTCAAGGGTGACACCGTCACAGGTTCGCGCGAGAACATGCTACCCATATCATAGGGAGTTGCCCAGAGCT
TGCAAGTGATCGTTAGTCGTTGGATCAACGCTGAGCGAGGAAGAACAGCTCGCAGGCCTGACGCGCGTGAACCAAACAAAGAGAAATGCTTTCTATTTGC
AGTAGAGGATATTTTCATCCAGACGGCAAAGAAACTATCGTTCCGATGTCACCGTATTTGGTAGGTATGAATGAGTATGAGGTGGGCTTCTTGTGCAAGT
CAGTCGTGAATTACGAATTGCATTATGAACGAGCTTAAGCTAAAGAAAAGTGTGGAACTACTGCTTGCAAGGTTGGAACACGCTCGTCTGGATTAGGGAG
GAGCACAACATGCTTTTCAGTGGAAAAGGTTTCACACGTCTCTGATAACACCGGGCTCACCAACATTCGAAGTGACCAGCACGCTGGCGCGATTCTCGTC
GTCGGGGCTGACCTTCTCCTTGCATGGTGATTTAGTGTCACCACCCGCTAGACTTCCGATTGTTTGTTTGATGCCGAATGCTGCCAACCCCACGGCAGCG
ATGGCGCCGACACACGCTACCCCGCCAATAGACCAGTTGACCGCTGTGCTCTTGTGCGGGTCGAGATCTTCGGAGCTTGGTCCCCTCTCTTCGGCAGAAA
TGGCACGGGGCACTCCGCCTGAAAGACTGGTGCTGCTTCCTTCATCTGAGGGAGTGCTGTCTGTACCGGATAGGTCATAAGCCACGCTGCTGCTGTTCAC
AATCGCACAGTATTCCAGATACTCAGAGGTGTTTGTAGGGAACCTCATGCAGTACCGGCAGCCTGCGTCGCCGATGCAGCCTGACGCCAGGCCCTCTGGG
CAGTGAGTAGTATCGAGAACGACGCCAATGCCTCCTTCCGCTTGACCATCAGCCAACGACACATCTGCACATACATCATCCACTTCCGATGTAAATTCCG
TCGACTCGTGCAGTGCTACAATCGTGTCCGCAGAGATGGTCTCGTGTGTGTCCCCGATGAAGGGGATCGTCTTGAAGTTGATGTCAGCGCCGTTGTCGGA
GGAGGGAATATCGGAACAATTCATGTACGAGTGTGACTGGGTTGTCTCGAATCGCTTGCAAAAACGGCAGGTGCTATCCACACAACCAACGCCGCCATCA
CCACATCGGATATCGGTGACGATGTCCAAGCCAAGACTCTTGTCGCCATTAGACGCGGTTTGATAGCAATCTAGCGGAATTGAATAGTTGGATGTTGTAG
AGACTGGAGCAGTTGTCGGGGCGGCAGAACTCACAACAGGAGTGACAGTGGCAGTAGCGGAGGAAGTACTCGCAACAGGCGAGTAGTCCGAGCAGCTCCC
CAAATGCGCCGATTGAACCGTCGATTTCGTCTTGCAAAGACGACAGACACTATCCATACAACCCAGTCCACCGTTTGTACAGCTCGCATCCGTGATGATG
TTGATTCCAACCGCGGCATCGCCATCCGCCACAGTTGACGTACAAACCTTGGTAGGGCTTGTGGTCGTGGGAGCGGTGGATGGACAGCTATTCAGATGCG
CTGCCTGGGTGGTGTCCTGTGTCTTGCAATACCGACAAACAGTGTCGATGCATCCAGTGCCGCCACTTGAACAACTAGTGTCTGTTACAATGTTAATGCC
GACAGCTGCATCGCCAGCGCTTACGGTCATGGCACAAGTGCTGGCAGAAGTTGCTTCAATACTTTCGTACGACGATTCCGTGTTGTCAGCAGACGCATCA
GAGCTATCGGTGTCGTAGCTTGCATCTGTGCTTTCAGACGAATCCGTTGTGCTTCCAGAGGCGAGCCTTCGCGTCTGTGTCTCGGGATCGCTGACAACCG
GGATTGGTACGAAGTTGATGTCAGAGCCGACATCTGCGGACGGAATACTGGAGCAATTGAGGTACGCCTGCGACTGGATCGTATCAAATCGTTTGCAGAA
GCGGCACACATCATCCAAACAACCGGTTCCACCCTCGCTGCAGCTGATATCGGAGACGACATCCAGCCCAACTCCTTTGTCTCCACTTGAAACTGTGCGT
GAGCACTCGAAGACGATTGAAGGAGTACTGGAAGTTGCTGTCGTTGTGGGTGTCGGTGATGGCGTGGCTGTCGTTGTCGGGGTGATTGCTGTCGGAGCCT
GAGTACTCGTACCCGTGATTGTAGCACAATCCACGTAAGACGAGGATTGGGTAGTTGTCGTAAGTCTGCAAAAGCGACACGCAGCATCGATGCAGCCTAA
GCCGCCTGCCGCGCATGAAGTGTCCGTGACAATACTTATTCCTGCTGCCACATCACCCGCTGCCGCCGTAATGCTACAAACTGCAGTAGGAGTCGTTGGA
GCCGGCGTTGGAGTCACGGGAACGGTTGGTGCTGGCGTCTTAGTCGGAGCCGCTGTACTTGGTGCGGGTGTGACTGTCGGAGCTGCCGTGGTAGTTGGTG
CTGGCGTTTTAGTCGGAGCCGCTGTGCTTGGTGTGGGTGCGACTGTCGGAGCTGCCGTGGTAGTTGGTGCAGGTGTGATTGCCGTTCCTTCAATCGAGGC
GCAGTCCATGAACGGCGCGGACTGAGCGCTAGTCGTCACTCTGCAAAAGCGGCACACCTGATCAAGGCACCCCAAGCCTCCGTTGGCGCAACTAAAGTCG
GTGACGATCTTGATACCGACTGCTGCATCACCCTCCGACACTGTCTGGGTGCACGGCTGCTTTGTCGGTGTTGGTGCAGCGGTAGCTGGAACTGCGGTGA
CAGCTGTGGTCGGGGCCGGAGTGGTGGTTATTGGAGCTTGCGTAGTCGAACCGGAGCCCCCAATCAAGGTACAGTCGACATAAGAAGCAGATTGAGTCGT
CACGGTTGCTCGGCAAAATCGGCAGACATTGTCGATGCATCCCAGCCCACCCTGTGCACATGTCGTGTCCGTAACGATTTTGATGCCAACGGTGGCGTCC
CCTTCCGAAGCAACTTGGCTGCACAAGGGCGCGGCTGTAGTCGAGACAATGTTCGAGCAGTTCTGCAGGTACGCCGATTGGGGGGTTGATCTTGCTCGGC
AAAGACGGCAGACGTTGTCCAGACATCCAAGGCCGCCGTCCACACAGGTCGCATCGCTCATGATGTTAATGCCTACTGCGGCGTTACTCTCAGATACCGT
CGTTGTGCAAACCTTAACCGTGGCAGGGCAAGCGTCCAAGTGTGCAGACTGCGTCGTGTTTGTGGCTCTGCAGAAACGGCAAACGCTGTCAATGCACCCG
GTGCCTCCACTGGCGCAGCTCGTGTCCGTCACGACACTGATACCAACCGCTACGTCGCCATCCGTCGCTGTCAAGTTGCACACAATAGCAGAGCCCGCCT
CAAAGGCAACGTCTTCATGCAAGCCAGGTGAACCACTTGTCGAGATGGAAGACTCGGAAGGTTTAGCGTCACTAGTGACTACGATCGGCACGAGACCAAC
ACCCCCTGCATCGCTGTTGGTACTAGACCCTGAGGTACTGCTTTGGCCTTCGACCCACGGGCACGACACAAACTGGGACGACTGGGAAGTTGACTCAGTC
TGGCAAAATCTGCAGTGATCATTAAAGCAGCCGA