Description :
From Genome Similarity Track
Location :
scaffold_680:13318- 14608
Transcript NameFunction/comments
g9837.t1 glutathione S-transferase, putative

Sequence
1290 bases(100 bases per row)
ATCGGCATTCTCCGATTTCCTCCACTCCACTCAAGTGCAGCCTCAATGTCAACGTTCCCGTCGATCAAGCTCACGTATTTCAACTTCGCCGGCCGGGCTG
AGTCTGCTCGACTCGCGTTCTACGTTGGCGGCGTCCCCTTTGAAGACAATCGACTGACCCGCGAGGAGTTCGCAGCTCTGAAGAGCTCATTACCACTCGG
CCAAGTTCCGGTGTTGGAGGTGGATGGGCAAGTGTTGACGCAGGCGTTCGCCATCCTGCGGTACGCCGGACGCCTCGGCGGTCTCTACCCCACCAATTCC
CCGTTCGCGGCACTCAAAGTGGACGAGATTCTCTACGCTTTGTGCGAGATGTGGGAGCAAATGCTGCCGTCCTTTCAAGAGAAGGATGAGACCAAGAGGA
AGGAGATGCGTGAGGAGCTGGCGACGGTTACCATCCCTCGCTATGCCGCTCGGATTGATGCTCGTCTGGAAAAAATGCACCAAATGCCAACCTTTCAATC
GGACACTTTGTTTGTGCACGAAATCGCTCTGTACACGTCGACGAAGGCGTTCAAAGACGGCATGTTTGACCACATCCCCGCTACACTTCTGGATGGCTAC
AAGTTCCACAAAATGATATTCAACAAGGTCACAGGGAACCAGAAGGTCAAAGAATGGTACAGCTTACCACACGGCACGCCGAAGCTCAAGCTGACCTACT
TCCCTTTCGCTGGTCGTGCGGAGCCCATTCGTCTCGCTTTCTTCATTGGAGGCATCGACTTCGAGGATGAGCGGATCTCGTTTGAAGAGTACGCGAAGGT
CAAGTCGAACCTACCTTTTAGCCAGCTACCCGTGCTGGAAGTCGACGGCGAGCCTGTAGCGCAGTCGTTGGCTATACTGCGTTATGCAGGAACTCTTGCG
GGTCTCTATCCAGCCACGGATGCACTCGCCGCTTTTCACGTGGATGAATTCTTCATCCTCATCGATGAAATGTTCAACAACCCCGAGTGGCGCGCAACTA
TTAGTGAGAGGGACCCCGATAAACTACAGAAGATGCGCGAGGGTTTATCCAAGGGGATCATCCTGAAGACTCTTGAGTCTCTGGAAAAGCGTGCCGCTGC
TTTCGAAGGCAAATACGCCACGGGATCGAAGCTAACGGTTGCAGATTTGGCTGTCTACGCTGTGGTTCTTCTTCTGAAAGCTGGCAGACCTGGCATTCCT
ACAAACATCACTGATCAGTACAAGAATTTGCTGCGCATCTTCGATCAGGTGAAGGAACACTCGAAGGTTGTCGAGTGGAATGCTGCCCAC