Description :
From Genome Similarity Track
Location :
contig_25:133147- 135644
Transcript NameFunction/comments
g5806.t1hypothetical protein

Sequence
2497 bases(100 bases per row)
ACAACCACCTGGGAGAACACGAAGAAATAGCCGGCCAGGACGATGCAGAGAGTGGAGGCGAAGACGACCAGGAAGGAGCACGCAACGAGCGCGAGTTCCT
TTTGGATACAGCGTCAAGTCTTGGGCGCTTACTACAGCCCACGCCGTCCTATGCGTGCCAGATCGCCGAGTTGAATCTGCAGGGCAATCGTCTTGGCAGT
GAGAGCTGTCGGCTGCTCTGCGCTGCACTAGACGCTGCGGGATCAGCGTCTCCATTACGTCGTCTGAATCTCAACGGAAATCCGCTAGGACCCGTGGGAG
GCCACGCCATCGCAGTGCTACTAGCTGCCACTACTTGCCCGCTGCAGGAGCTCGACGTGGGCAACACCGAGCTCGACGTCTCCAATCTCATTGCCATAGC
GCAGTCGCTGCGTGGCAACCGCAGTCTCAAGGCACTCAATCTCGACAATCCCATTGTACGCACAAAAGAGGAGGAAGCGATCCAATACATCGGGAAAATG
TTGCAAGTGAACCGCGTGCTCACGAATCTAAGCTTAGCGAAGCATCAAATGACGGATCACGGCGCGCAGGTGCTGGCTGAGCGCTTGCTGGACAACCGCT
CGCTACGACGACTCGTGCTGCGTGCCAACCGAATCAGTAGTACAGGAGCCTCTGCGCTTGCAGCTATGCTACTCCACCACCCAACGCTGGCTGAATTTGA
TCTCAGTGCCAACCGAATCGGAGACGCTGGCGCGAAAGCCTTTGCACAAGTGCTGCGAGCCAATATGAGCAGTCCGTTGGAGGTGCTGTCACTCTGCTCT
ACGTCCCTCACAGACGACGGCATGGCAGCGCTTGCTACAGCGTGTCTGAGACCACAGAACTCAGAAGCAGGCTCACGCTTACGCTGCCTCCTGCTTTGGG
GGAACATCTTCGGCCCCAAGACGTCGCCGCTGGTGCTGGAGCTGTGCGAGCCCGGAGGTCGCTTCCACGAGTACAGCGTCGAGACCGACTTTATGCCGCG
CCTTGTGGACGATGAGGTGCTTGTTGCACACCAAGAAGCGTACCACTTCCCACGGTTCGCGTCGCCCAAGAAAAGTTAAGTTGCCTTTCACTTCAACTTG
AAAATCAACCTAAACGTCAATCTAAAAAATGAAATCATCCTGAAAATCAACCTAAAACAATCTCGGCGCAAAATGCTCCGCCGATTCCTGTCGAGGCGCC
CGCGCGTAGCTGTCCCCATCGTGGCTCTCGAGCATCCTGCGAGAGCGCTACCTACCACAGGATTATCCCAAACATGTTGCAATGCTGCTCACCAAATTCG
GGGCTCGTCGTGCCGCTCCTTCTTTCACTACGCTGCATGGAAAACATCGCTCATTGATGCCCGATGGTTGTCAACCACTGGTGCCCCTCCAAACGACGAG
TCCTTTGCGTCCGTCGCTGGTCATGCGCAGCGAGAGATTGCAGATATCCACGATGTGATAGCCACCACCCATACCAAGCAGGAACTCACTGAGCTGCGAG
AAGAAGCCGCAGACCCGAATCTCTGGGACGATGCCACTACCGCCGCCTCGGTGGTGCAGCGGCTGGCTGCACTGGAGTCGAGGGAAACGCGCGCGCATGA
ACTGCAGCGGAGGTTCTTAGATACGAAGGAGCTGTACGTGATGGCGACGGAGGAGTCCGACGAGCCCATGATAAGGGACTGTGTGAACGCAATGACTGCA
GTCCGGACTGGTGCACAGCAGCTCCGACTGGAACTGCTGCTGTCCCATGAGAGTGATGCGCGGTCCTGCTTTCTGGAGATTCAAGCGGGGGCTGGAGGCA
CTGATAGCTGCGACTGGACGGCCATGTTGGCGAGGATGTACGCGCGGTGGGGCGAGGCACGGGGTTTCCAAGTGCAGCACGTGGACGAGTCGGTGGGAGA
TGAAGCTGGCTTCCGATCTGTGGTGTTGCGGCTGGACGGTGCGTACGCATACGGTTGGGCAAAGAGTGAAGCTGGTGTGCATCGCCTTGTGCGCATTTCG
CCGTTTGATAGCGCAGGGAGGAGACATACGTCTTTCGCGCAAGTGCGCGTGTACCCTATGGCCTCTGAGGGTCGCTCCAAAGAGGAGATCGAGATCCCAA
CCAAGGATCTACGTATCGACACGTTCCGATCGTCGGGTCCTGGCGGGCAGCATGTGAACAGCACGGATAGTGCCATTCGAATCACGCACTTACCCACGGG
GATTGTTGTGCAGAGCCAATCGGACCGATCACAGCACCGTAATAAAGCTGAAGCGCTGGCCATGCTCCGTGCTAAGCTGTACCAGCGCAAGCTCGAAGAA
GAAGCTCTCAAGAGGCAGCAGTTCGCACAAGGGCTTGGAGACAATGCCTGGGGTAACCAGATCCGGTCCTACGTGTTGCATCCGTACCAAATGGTGAAGG
ACCATCGCACCAATTACTCCGAAACCAACACAGCGCAGGTTCTCGACGGCGATATCGACCAGTTCGTCGAGAAGATGCTACTGCACCAAGCAGCATC