Description :
From Genome Similarity Track
Location :
contig_25:133142- 135287
Transcript NameFunction/comments
g6086.t1hypothetical protein

Sequence
2145 bases(100 bases per row)
CGTTACAACCACCTGGGAGAACACGAAGAAATAGCCGGCCAGGACGATGCAGAGAGTGGAGGCGAAGACGACCAGGAAGGAGCACGCAACGAGCGCGAGT
TCCTTTTGGATACAGCGTCAAGTCTTGGGCGCTTACTACAGCCCACGCCGTCCTATGCGTGCCAGATCGCCGAGTTGAATCTGCAGGGCAATCGTCTTGG
CAGTGAGAGCTGTCGGCTGCTCTGCGCTGCACTAGACGCTGCGGGATCAGCGTCTCCATTACGTCGTCTGAATCTCAACGGAAATCCGCTAGGACCCGTG
GGAGGCCACGCCATCGCAGTGCTACTAGCTGCCACTACTTGCCCGCTGCAGGAGCTCGACGTGGGCAACACCGAGCTCGACGTCTCCAATCTCATTGCCA
TAGCGCAGTCGCTGCGTGGCAACCGCAGTCTCAAGGCACTCAATCTCGACAATCCCATTGTACGCACAAAAGAGGAGGAAGCGATCCAATACATCGGGAA
AATGTTGCAAGTGAACCGCGTGCTCACGAATCTAAGCTTAGCGAAGCATCAAATGACGGATCACGGCGCGCAGGTGCTGGCTGAGCGCTTGCTGGACAAC
CGCTCGCTACGACGACTCGTGCTGCGTGCCAACCGAATCAGTAGTACAGGAGCCTCTGCGCTTGCAGCTATGCTACTCCACCACCCAACGCTGGCTGAAT
TTGATCTCAGTGCCAACCGAATCGGAGACGCTGGCGCGAAAGCCTTTGCACAAGTGCTGCGAGCCAATATGAGCAGTCCGTTGGAGGTGCTGTCACTCTG
CTCTACGTCCCTCACAGACGACGGCATGGCAGCGCTTGCTACAGCGTGTCTGAGACCACAGAACTCAGAAGCAGGCTCACGCTTACGCTGCCTCCTGCTT
TGGGGGAACATCTTCGGCCCCAAGACGTCGCCGCTGGTGCTGGAGCTGTGCGAGCCCGGAGGTCGCTTCCACGAGTACAGCGTCGAGACCGACTTTATGC
CGCGCCTTGTGGACGATGAGGTGCTTGTTGCACACCAAGAAGCGTACCACTTCCCACGGTTCGCGTCGCCCAAGAAAAGTTAAGTTGCCTTTCACTTCAA
CTTGAAAATCAACCTAAACGTCAATCTAAAAAATGAAATCATCCTGAAAATCAACCTAAAACAATCTCGGCGCAAAATGCTCCGCCGATTCCTGTCGAGG
CGCCCGCGCGTAGCTGTCCCCATCGTGGCTCTCGAGCATCCTGCGAGAGCGCTACCTACCACAGGATTATCCCAAACATGTTGCAATGCTGCTCACCAAA
TTCGGGGCTCGTCGTGCCGCTCCTTCTTTCACTACGCTGCATGGAAAACATCGCTCATTGATGCCCGATGGTTGTCAACCACTGGTGCCCCTCCAAACGA
CGAGTCCTTTGCGTCCGTCGCTGGTCATGCGCAGCGAGAGATTGCAGATATCCACGATGTGATAGCCACCACCCATACCAAGCAGGAACTCACTGAGCTG
CGAGAAGAAGCCGCAGACCCGAATCTCTGGGACGATGCCACTACCGCCGCCTCGGTGGTGCAGCGGCTGGCTGCACTGGAGTCGAGGGAAACGCGCGCGC
ATGAACTGCAGCGGAGGTTCTTAGATACGAAGGAGCTGTACGTGATGGCGACGGAGGAGTCCGACGAGCCCATGATAAGGGACTGTGTGAACGCAATGAC
TGCAGTCCGGACTGGTGCACAGCAGCTCCGACTGGAACTGCTGCTGTCCCATGAGAGTGATGCGCGGTCCTGCTTTCTGGAGATTCAAGCGGGGGCTGGA
GGCACTGATAGCTGCGACTGGACGGCCATGTTGGCGAGGATGTACGCGCGGTGGGGCGAGGCACGGGGTTTCCAAGTGCAGCACGTGGACGAGTCGGTGG
GAGATGAAGCTGGCTTCCGATCTGTGGTGTTGCGGCTGGACGGTGCGTACGCATACGGTTGGGCAAAGAGTGAAGCTGGTGTGCATCGCCTTGTGCGCAT
TTCGCCGTTTGATAGCGCAGGGAGGAGACATACGTCTTTCGCGCAAGTGCGCGTGTACCCTATGGCCTCTGAGGGTCGCTCCAAAGAGGAGATCGAGATC
CCAACCAAGGATCTACGTATCGACACGTTCCGATCGTCGGGTCCT