Description :
From Genome Similarity Track
Location :
contig_137:13312- 15525
Transcript NameFunction/comments
g13697.t1hypothetical protein

Sequence
2213 bases(100 bases per row)
TGTTGTCTTGCGGAAGATCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTGATTGAAGCGGAGCCTGCGAGTTGGGCGC
AGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACGTGCGTACCCATTTGTACTGGTGACTCCAATAGAAGTCACGCGTGAGAAGTAAATATGTC
TTCTCACGGTCAGGATGTCCCGATGTCGGGGTATCGTGATACTCGTACGTGATCTTGAGCTTCAGCTCATGATCATCCGGCACGACAATGGGATCTGCGT
TGTCGTCGACTGCGCTGTAAAGCAGCAGGCCATTGTGTACACGGTAACGGTGTACACGAGCACGAAGGTGTTTGGCCAGCTTCTGACGAGATTTGTCAGA
AGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATACGCGTATGCGGCCTTCACGTCATCCAAACAAGGACGACGAGGGTGTAGTCGTCCT
GACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACGACATTCAACCTGGAAGTTGTATTCCGT
AAAGAATGACAGCCACCGTGCCATTCTTTGGGATATGTGCGGTGATTTGATCGCCGTACGTAATGATGCGTGGTCAGTGTAGACCACGAATGGTCTACTC
CCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCG
ATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCG
ATCTTGGTCGGCCACCGCCAAGATCGCCGCCTCAGTCAAGCCCTGCTTGACGGCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCT
TTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGTACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTA
CGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGT
CGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATGAGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGAT
TTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACG
TCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGCGTGAGAGGGATATCACTCTCACGCATG
AGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTG
CCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTT
CGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTAC
TTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGA
CCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAG
CTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTC
CAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTATTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGTACGCGTCAAGA
CACTCAATGTCTC