Description :
From Genome Similarity Track
Location :
Scaffold_327:1331- 5191
Transcript NameFunction/comments
Hyaar_Emoy2813773PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
3860 bases(100 bases per row)
CTAGTTTAGGATGTTTTACTATTTCCAAGGTTATATCCTTTACGGTATGTATGCCCATTCACCACGAACTTCACGTTGGAGGCGTTGAGTTTGCAAACAA
CGGTGATGCGTTGATTATGTTAAGTCGTTCAGCAAGCCAGGTGATCCAAAATTGGCGTGCCAGAATCACAGGTCTTGGTCGACCATGGCCTCAAGAACCA
GTGTCGACTTTTTACCTTTTCTCTGGTATTGCCCAGCAAGGCCTGTAGGGAAGTTCTTCCATTGCCAGTGCATGCAATCCATTGAACAAAGCATGACAGG
GAAGCCGCGTTCGTACGAAGTCAAAAAGAAGTGGATCAGGTCGTCCTCACATGGATACCTCAGGTACTCATTGCCGAACGGATCAGTAATACCATTTGTA
AAATGCTGAGTCGCCTGCAGAATGGTTGACTCGCCCATCTCCATATCATCGTATAGGCTATCAGAAGAGCTTCCACATTTGACAGTACACGCAAAGCGGC
TGTCACTTTAAGCAACGACGAGATTCCAAATTTCCCAGTTGTGTCCGGTTGCTGCTGGAAATAAAAGTCATTCGCTGTCACCGTATCTTGCACACGTTGG
GAACAGGCGCTTTGACATCCGGAAACGTCGACTAAAGACGTATCATTGTACGTCGGCGATACACCAAAGTATTGGTCGTACATTAGTTGGTGACGACGAT
TCCAATTGCGATTAACATCTGGTGCACAATTCTGGTGCGGATCCGCCAGTCGAGTTTCGACCATTTATAACAATCCACTGCTGCATTTTCATGATGTTAT
TATTGTTGAGCATCAACACTACGTACTCATCTTCATCATCATTGGCCTCAATCGTGCATTCATCGGGGCTGTCATCACTAGTAGCGGAGCAGGACGAAGA
AGAAGACCAGAAGTCATATATTTGCGTGATTCAAAGTTACGCAGTTTTTTAAATTTGCAAAGAGTTTTGAAAGATACGGGTGCACGAGAACTGCAATCAT
TTTATTTGCCATGGATGTTTTCTCACAGTTTGCGAGAAAAATGCTTCTTATGGTGGAGATTCTCTTATGGTAATTAATCATAGTATTTTAGTGCATGCTT
TCGGCACTCTTGGCATTTAGTGAAGACGCATTATCAGTAAACCAGTTCCAGAATGCGCTAGGATAGCGACCACGTTTCTGTTCCGGCGGCCAGCCGGATT
GTGTGTGAATCACACGATTGTCGGGGAAGGTAACCTAATAAAACCTGATTTTAAAAGATCGCAGGCTGTCGGGTTTTAATATAAAAAACATAAAAACCCG
ATTGTAAAAAAACACTTGGTGCCGGCCCTGATTTTGCCCCAGCATTGTCTTATCCGTCGTTCATATTGTGTTAGTCTTCTCATATGGCACTAATTTGTTT
TATTTTTTTGGCACATTACAGTCATTTAATTTTTTTAACGACCGAAATTGTCCGTCCGATTAAGGCCTACAAATCCCTCGTCGCTTTAATAGCTACGTAA
TTCTACACGCTACCACATGCACACTACTGCGGTGTGCCTTAATACTATCCATCGTCACCGCGCACCTGATCTGTGTGCGCTGTCCCATCCATTTCGAGCC
AGTGACCTAGGTCCCCCCTTAATGCCTCCTTGACGCTTTCCACCGTGGGGATAGCCTCTCCGCGTCCTCTTGGTTGATTTGGATGCTCAATTTCATCTCA
TATGGCACTATGTTGAATAATTACCAGGAAAGCGCCGCGTTTGTATCAACGTACGTGCTGGATCAGCCCTATCTTCTAGACCATGAAGTAGTAGTAGCTC
TTGGAAACAGCACCCATTGAATGTGAAGTTGTCTATGTAGTTAAAGAGGACATTGCTGAAGAAATTCTTCTATCATCATACCTAGAAAAACTTTCCAGCG
CAGCGTCCCACGCTAGTACCGAACGTTATCATGTGCGTGCAAGAGAACATAGCATGCTAGGCTAACGTCTCTGCTTTTGACGTTGTTCTAGTGTTCAATA
AGTTAGGAATATATGAGCCAATCTACGTCATCTTGAAGGAATAGGATAATTCAAAGAAATAGTGTACTAGCAATGTCATCCTGATCCGAATGGACACCGG
GAAGGCCAAACGCAAGTAGTTTAGGATTGGGTCCTGCGCGCTGGAATGGCGAGGATTGGACGTGGGTCTCTTTGTTATGATAAGGACGTTAGTCGTAGTG
TGTAGCACGTGCAAATTGCTGGAGGAAAAGTATCCATTGGTTGTATTACGCATCAGGCTATTGTTACGTGTTTTACGCCCGGAGCAGACCTGACATCGAT
GTGTCCGTTCATGTGATATTCTACTACTGCTGCTGCATTTAATCTTGGTAGCCTTTTTCCTAAATTTGGTTTTTACTGGATTATGGTACTTTGTAGATGG
TCGAGAGGTTTAGCGACGGAGCTGAAGACCTTTATCCTTGTTGAGACGCACCTTTGCCTGTTTTGTACGCTTCGCGACGATTTTGCTATTATTGAGGGCT
GCAGTGGCTTGGTGGTGGTGTCTGCCCAAATTTCGTGAGCATGTCTAGAGAGTGAATTGAATGATGGCTCTTACAGTCTCTGTGAAGTTGGTGCCACTAT
TTGCTGAAGCGGTGCGCACATATTGCATGAAGCGACGCGGTTACACGCTCACAGCATAGACCTCATTGACGTACATGATTATAATTCTGAAAATAATTGT
TCTATTTTCGGTGCTGATACTCATTGGCATGATTTGTCACCTCTGGAGGCTTATTTGTCGCGAAAAGACAAGCCTTTGCTGTCGCTGCAGGTGATTAGTA
ACATTGCCTAGATCTTAATGAAGGAGACCGCACCGCAGATGGTACTTGAGCTTAGTGTACATACGAAATATCTTCATTTGATGCGGATATTGTAATGGGA
CACCCCGTTACATAAGTAGTTTCTATTAAAGTTTACATGTTACTTAAGTAAGCGAGCTACTTCCGGACTAGCGGATGTAGCATGTCATATATCTTACTGG
GGTTAATGAGTTCGGACTCATTGTTAGCCAGTAAGATATCGACACGTAGATCGAGTGGTCCCCATGAGTCCAGGGAGCCACTCGTACTTAGGATCTAAAG
AAACAAAACATAAACAGAGTTAAATTCACTTAATACCTAAGACTTGGGCTTGAGTATTCCTCAAGCGTTAGTGTAAGCTAAGTACGGGTTGTTCTAGACC
CGTTACACCTGGTAGCACTTGTTGGTCTTTCCCATGCCCGAGTTTGGGATGGGCGATTCGTCGTACTTTGACGCTCCAGATTTAATTCTGGAGCATGCGA
CCTTCCCCCATCTCACTGGTGTTGAGTGGGATGCCCTGAATCGCCTCGCTGCAATTTCAGGAGAGGCTTTCATCGCTTCGCTGATGAGATTAGCAACCCC
TGATGAACAGCGCCTCGCCATCCACGATTTCATGGCTCGCGAGCTCGCCCAATCCGATCGGCGAGGTTTAACTCCCTCGCGTTCTTCACGGAATGATTCC
GTGAAAATGGAAACCTCCACCTATTTAGGCGAAGGTAAAGATCGATTGTCTTTAAGTCGCTGGTTTCGAGAAGTCGGTATCGCCATCACCTCGAGGCTTC
TCGAGGCGCCCGAGGCGAAGGTCAACTTCCTCATTTCCCGTCTCACTGGGAAAGCCAAGGAATGGGCCCTTGGTAAACTCGTCGTGGACGAGCACGCGTT
TCCCACCCTGGAGTCCATCCAGGATGACCTCTGTCTGGCCTTTGAGCCACCACAAGAAGAGAAGATGGGGCGCTCAAAGTTCCTGTCCATGCGAAAAAGT
AAAATGGCGATGCGAGACTACGTACAGATGGCCCGACACCTGGCTTCGTGTGTCATCACG