Description :
From Genome Similarity Track
Location :
Scaffold_4:1330609- 1365613
Transcript NameFunction/comments
Phyin_T30-4PITG_03297Putative uncharacterized protein
Phyin_T30-4PITG_03298Putative uncharacterized protein
Phyin_T30-4PITG_03299Putative uncharacterized protein
Phyin_T30-4PITG_03300U4/U6 small nuclear ribonucleoprotein Prp31
Phyin_T30-4PITG_03301DEAD/DEAH box RNA helicase%2C putative
Phyin_T30-4PITG_03302Putative uncharacterized protein
Phyin_T30-4PITG_03303Putative uncharacterized protein
Phyin_T30-4PITG_03304DEAD/DEAH box RNA helicase%2C putative
Phyin_T30-4PITG_03305Peptidase%2C putative
Phyin_T30-4PITG_03306HSF-type DNA-binding protein%2C putative
Phyin_T30-4PITG_03307Putative uncharacterized protein
Phyin_T30-4PITG_03308Putative uncharacterized protein
Phyin_T30-4PITG_03309Intraflagellar Transport Protein 140
Phyin_T30-4PITG_03310Putative uncharacterized protein
Phyin_T30-4PITG_03311Regulator of chromosome condensation (RCC1)-like protein
Phyin_T30-4PITG_03312Putative uncharacterized protein
Phyin_T30-4PITG_03313Putative uncharacterized protein
Phyin_T30-4PITG_03314Putative uncharacterized protein

Sequence
35004 bases(100 bases per row)
ATCGGTGTGCTTGGAACGCCTTCTGGACCAGAGTCTGGTCCCAACCATGACGTTCCCACCGAAGCAAGAGTATTTAGACGAAAACCCAGAGGCTCCAGCT
CTAGTATATCCCAAATCAATCGTCAAAACTATTGATGCAGTACTGGACTACAGCAATTCGTATCTTGGTGACGACAAGTTCATACAGATTATCGAGAAAG
CCCGACTCACTAGCGTCCCTACACGATTGGATCTGCGTGGCAATTGCTTCGAAGCTGGTGCTGCTCGAGAACTTGCGGCACTATTGCGCACCTTTCACAA
TGTGGTTGCCATCAGTCTGGAGTGGAACAACGTAGGTCTGCTGGATCAAGGGGTGGAAGCTCTCGCAAGTGCGCTGGAAGTAGATAAGCGGTTGCTAATA
CTCGATTTGCGCAACAATAACATAGGCCCCGAGGGTGCCAAAGCACTCGCAAAAGCTCTCCGAATCAATCGAACACTGCGTCAATTGGACTTGCGCTGGA
ATGAGATTGGGAATCCTGGAGTGCTGGCATTTCGTGAGGCGTTGCAGAGCAACCACTCGCTATTGACACTGGAACTCATGGGCAACAATTGCAGCTTGAA
GCACGTAGATGAAATCGAGCTACTCCTGGCTAGAAATCGTGCTTTCACGGAGAGACCACCGCCTCTGGCAGTCGATGCGTCGTGCCAAAACGATGAGGAG
AACAACGAAAGCCCGAAAACTGCTCCGGATGATCAGCTACTACTTCAAGTCCTAGCGGAGAAAGAGGAGCTGGAGACAACGATAAGTCTAGGCAAGCGAG
AACGGCAGAAAATGGTAAAGTATGAAAACGTATACTACTTTGCCTTAATCGCAGTGTTTCTCATGTGTGAATTGAGCTTCTCCCTAGATAGAGACAGCTG
AAGAGCTCGAACTACAGCTGCAACAAGCTCGCAAAGATACTGAGATGGCAAAAGAAGATCGAGACCGCTATCAGCAACGTGAGATCGATGCAAAGCGCGA
CGTCCATGAGCTGAGGATGCAGCTGGACGAGCTTGAAACCCGTAGGAAGCTGGAGTTTGAAGAGTATAGATTGGCTCGAGCAGCACTTGAGCGTGAGAAT
GGCGTTTTTCGGGAGAAAATTGGGCACACGGAAGCTCTGCGCAGCAAAGAAGCAGATCAGAAGGACAAGCAGATTTCTCAACTGGAAGAGACCAAATATG
CCTTAGACAACGAGCTGCATCGCTCGTCTATCACGATAAGGTAACACATATCAGCTTACCAGCTAAAGTCATTCGATGTAGCATCGCTTTCTAACGAATT
ACGGACGTGTTTGGCAGGACGCAAGAAGAAGAAATCGGCAAGCTACAGAAACAACTTCAAGATGCTCAACAGGATTACACCCGCAAACTAACCACGTTGG
TGTCGGACCACGAAGGAAAGCTAAGTGCGGCTCAACGGCAGCATGATATGGTTGTTGGGTCCATGCAGACGCAGCTCAGCTACTCCTCCACACAGCTTGA
AACGAGTGAACGGAGTTTTCGTGAGCTCAAGGAAAAATGCGAAGCTCTACAATCGAAAGTGCTGCAGTCTCAGATTGACCAGGAGAAGGCAATTGGGGAT
CTGAAGCAGCAGTGGGAAGCAGAGCTGGAGGAACGCATCCAGCGCTCGGTTGGGTCGGTCGAGGCTCAAGTGGCAGAGGTGAAGAAGGCGCGACAGCACC
TTGAGCGAGAAGTAGAAAAACACCTCGAAACCATTATCCACCTCCGCCAGCAGAATGTATCTCTACAGCAAGCAAAGGATGAAAAGCAGCATGAAATGGA
GACTGCGTTGGAGACGCAAGTCAAGGTGCTGCACGAGAAACAAACGCTGCTAGCTGCCGCGGTGAGCGAACGATCTCGCATCGAGGAGAAGTTGCAGCTT
CAGCTACGTAAGATGGAGGAACAGGACGCTCGACTCGTGCAGATGCAGGCAAACTTCGACGAACGGATTCAGGTGCGTCCGCCAACAGTCAAAGCTTCCC
GCGTTGCACTTACCTAGGTTTTTTTTCCTTATTGTGTCTAGACTCTGACTGCCAGCGCAAAGATTGCGGCTGAGGAGAGCGCCACCACCTTGAAGGAGAG
GGCAACGCTGATCGCGTCTCTTGAGGGTCATGTGCTTCAACTCGAGCGGGAGCTGTCAGCGCAGAACCATGAGCACGAAAAGCGCATCGACGACTTGGCG
GAAAGCTTTGGACGTTTCGTACAGGATCAAATCGGTAAAGAGCGCGAACGACGCAAGAAACTGTCAGCGACGCCAAGTTCCGACCTCTAAAGCTGTACAG
GGTAGAATCTACCGTGGACCATGTGCCATCGCTGGCCCGCTCCAGCTGTAGTCTGCATCGCTTGATGTCACAAACAGCGTTTCAAGTGCGGTAACGATAA
ATGAATCATTTGTCATTTAAAATAATACATGCATGGCATTGAATTGACGTTGAAGTGGTCCTGTAGTTTGGATGTGACAGGCTCGGGGCTTGACAGTGAC
CGAAAATCGAATATTTGTCCCACCATGTCACTGGGCGCGATCTTTCTTCGAGCGTTTGGATATCAAACTGCACTCGTCTGGATTCGTCAAAAGCTTCTTT
CATTGGCTGAATGTCGAAGCGGCGTCATGGGCTAAGCGTCTAGGGAGGGCCAGAAAGAGACCGGAAAAGCAGCAGACATGCCAAACGTGTGCACTGCGGT
GAGGCGGTCTGTTCGCCATTCGCAGATTCACCTTGGAGGGCTCACGCGAACGAGTTTCTTGACTTGTGCATTTTTGTGCATTGCAAGTAACGTCTCAGTT
GCCCCGCCGAGAGAAAATAAGCCAATTGAATTCACATCCCTTTGCAATGGACGGCAGCACGAGTGTGCAGAGGCTCATTGACCAGTTCGAGCTCATGGCG
CAAACCAATTCCAAATCTGCAGCCCCATGCACGTGGTCCACAACGAGGAACACGAAAGCACCACTGCCAAAGCCCGACGGCAGTCATCACGACTCACCGG
TGGAGGAAATTATGAATTGCTTTTACAAGCAACACACTCAAACGACAGATGAACCTGATGAAAAGGCGATACAGGATGCCGTTGATGTAATTCCTGCAAC
CCCCGCGAAACCGACAATCTACAAAGGCCTTACGATCAACATCTTGCAGCCTACTGACGATGTCACTGCCTACGAAGATGGGAGCACTCCGATCAAGTCC
ACGTACTACTTGGCCATGCCTCGCAGTCCGTCGACTTACTCAACTGCTTCCACGTGCTCATTGGACTCGTCATTGAGTTCGTTGGATATGTTCTTTCCAG
AATTGCTTCAGGCGTCAGGCAGGACCGCCTCGGAGACCACTAACTTACATTCGACGAAGGCCTCCAAGTTGGCCCCACCACCGTTATACCGATGTGCAAC
ATTGACCGAGAAGCCGATGAAAAAGCCGTCAAACCTGGCTTCCGCAGCGCCAATGTCGGCGAGGCCTCGTCGCTCTTCACTCTCGTCGTCGATGGTTCCT
TCCACAGCCAATTCAACGCACTGTTTCTCGGAGGGGGCGTGCAATACCCTTTGCGCAAGAAGCTACTCGTCCTCATCGCCTGTCGCTCGGTACATGGACT
ACGATAGGTCGCCACGTTTCGCGGCCACGAAGGCCATGAATGTGGAACGCCGTCGCCGCCTGCAGGAGCGCAACCGAAATATTGCCTTCAACAAGGTGAT
GCGCAGCGAAATTAAGCCCCGTACGCCGGAGTGGCAGGGTCGTCTCGACCACGTGCGCTCACGATTATTTGACTTTAAGGAAAACAACCAATCCCTTACG
TCGAAGGCGAAGAAAACGGCATCGCGAAGGCACTCCACTTCGAACTGCCCTCTTGCCTAGAGTATGCCGATGTCCAGCTTTTTTAATCGCTGCCGTGAGT
AGTAGGTTATCGTGTCAACTAGCGCTGGTGCCACAATAACTGATAAGCTTACGATAAAATTATTAGAAGATTTACTCGTTTCTCCAACGGTCTCATACTT
ACACTTTTCGATCATTGTCGTTTGATTGGCTGAAAACGTGTGGCCCCCGCACCAGTGACACAAAGACATGACGGTAGTCCATTCAGTCCGATGCCGCCTG
AATACAGTGTTGCCGCGAGTTACTACTGCCTTAATGCAAGCGATAAAGCTGCAGAAGACGATAATATCGTCAAAACCCCAAAGCCCAGTGAAGCTGTGAC
AAGGCCACAGATCGATATCGTCTCTGATAATGCCGTGCAGGTACCGCGGCTACCGCTAAACGAACTCAACTGGAAGAATCGCACTCGGTTCTTGGAAATG
ATGCAGCGCCACTCATTTGTAGTACTCACGGACCTCGGTGAAATTCTAGAGCGCACGCACGACCAGGTGCTGCAGGACTTCGAGACATTTTTCACTAGCG
ATGATGAGGACTGGAAAAATAGCTGTACCAGCAAGCACGTTTACCTCAATGAGCACGGTAAACCGTTCTGGTACGCTGGGTATGAACACACAAGTGTGCG
TGACTGCTTCCGCGTGGCGTGTGGTGATATGTCAAGGCTCGTGTGGCCATCGCCAGATTTCAAGAAGCACTGGTTGTCTCTTCAGCGCCACATGCAGCGT
ATCTGTGATCGGGCTTTGAGCTTGACTGTCGGATACAATATTGAAGCTAGCAATGCGCGCACTGACAAGGACTTTTCGGTGTGCTATGGTCTGCACTACC
CGAACATCGAGGGCAGCGGCCAATCCAAAACGGAGAATGTTTTTGAGCATGTGGACCCGAGTCTGTATGTCGTGGAGCCTGTGCCTAATGTGGAAGGCTT
GGATGTGTATGACCAACACTCCAAGCAGTGGCTCAAGGCCGAAAAAGTGTGCGTTCCCGGCAAGGAAATTGTCCTTTTCTGTGGTCATGCCTTGAATCGA
GCCACGAAAGGTCGGATCCCAGGAACGCTGCACCGCGTTCGACGCACCCCAGACCGGCGATTCTGCATAATTTATGAGCAGAAGTACGAAGAGTATTTCC
TTTAACTCGAGCTCGATGGAATTACTGAACAAAGCACCCGAACATGAAAAGTGATTTTATCCGCTTCCCATCCATGAGCTGGTCTACGACCAGCTCAGCC
AGCGCGTAGCTCGTTCGTCGTTCAGGAACAGCAATCTCCCGCAGAAATTCATACTTTTACTTCATCGACCGCTGAATGATTCCTTGCGGTTCCAACAAAA
GTATTCTTAGAGAATATGAAGCAAGTATTATCTGCTCCCATCTGAAAATAATGGCTTTCACTTTGGTTAGAAATTGCTTCCAGCCGCGCAATACTAATAA
CACACCATTAAACCCCACAAATACCTGTACTGTAGATGTACTTCGCGTACTTCCTGACTGGGAAAACGCAATTTTCGACATCATTTTTCCAGTAGTTGAT
GTTGATTATTACTACGTAGTAATAATGACTCGAAGGTTTGTCGATGACGATTACATGTATCACGCCAACACTGACGTTTGTTAGTCTCTGAGCCCGAATA
CCAATCCATCAAGGCAGATTTTGTGCGCTATTAATATCAGCCAATCTCCAGATGTACTAACTGTATTCAATGTCCGGCGATCTGTCCCTGCCTCCCCATT
TCCCATTTGTGTTGTGAAAGAAGAAAAACAGTCGATCCATCAAGAAATTCAAAATGATCAGTGGTCGATCACTTCTTTCGATATCACTCGCAATGGCCAT
CTACGCCAACTCACTCTCACAAGTTGAAGCCTATCGGATTTCGATCAAAACAACTCCAATTCTCGACTAGTGGGAAGGCTGGGGGACAGCGCTCAAATGG
TGGGCCAACGCCTTTGGTGATCGCGAGGACATCGCTGACTTGCTTCTTTCCAACTTGTCGTCAGTGTCAATCGATGGCGCAGTTAAAGACATCCCCGCTC
TTGATCTCAACATTGCACGGTACAACATCGGTGGTTCGGGAAAAAACGTCATAGACGACAGCAAGACAGAGATCGCAATGAAGAAGTCAGAGAAGATGCC
TGCGTTCAAGATAATTGAGTCGTTCTGATTGGACTGGACCAGCCCCCTGCGTCGGAGAGCTGAAATTGGGAAGCAGATGCGAAGCAGCGAGCTATGCTGG
GGTTGGCATCGAAGCGTGGTGCCAATGTTTTCGAGGCGTACTCGAACTATCCTCCTTGGTGGATGATGAACAACCGCGCCACTGCTGGTGGTGACGACGA
AACTGCTGATAACCTAAAAGCTGAATACTTTGAGCAGTTTGCAGTGTACCTGGCAACTGTGGTAATCAAGACTGGGGTATCGAGTTCAAATAGGTCGCTC
CGTTCACCAAGGCGAACAGCAAGGGTTGGACTTTTCCGGAGTCTCAGGAGGCCAGTCACTTGGAAATTAAGACGCAAAGCGACATTTTGAAGCTCTTCCG
AACGCAGTTAGATAAACTCCACCTCCAGAATGTGCTCATTGCAGGAGCTGAAGAAAAAACTCCTGAAGGAGCTCTCCACGTAGTTGTGCAAAGACACAAA
GCGAACATCCTGGTATAGATGCCATTGCAAATGTTGACGCGAATTGTTCCGATGGCGTGGTTCCTTACGCCGGTGACGACCGCGACAAGCTGAGAGGAAT
GGTTTCTTCATTGACCAAGCGGCCGTCTATCTGGGATTCCATGGATGCCGATGAAGATTCACCATGGCCAATACTATCGCTCGAGACATCAACGAAATGG
GTGCTTCAGCTTTCGTGAACAGACAAGCGCTTGATAATGGAGTGGTGGGGCTTATTCAATCGAACTCGAGAGACAAATGGATCGGCACCGCAAACCCGAA
GCACTACGCGATGGCCCACTACTCCCGTCACATCCGTGCTGGCATGAGCATCTTGAAGTTCGACGATCCAAAAACTTTGCTTCGCGGTTCTTCTTCATAT
GCTCTGGACATATATCCGAACTTCGTCGTTGCATACGACAAAGCCACTCAAATGATGGTGATCGTAGCGACGAATTTGAGAGACGCTCTAACTATCATCT
TCGACTTGTCTGACCTGGCTTTTGTTGAAGGACCGATTAATACTTGGACAACGGAGCCGAACACCACCATTGGAGCTGTGTACAAAGCCGTGAGCATCGA
CATCCTCTTTGGCCAAAGCGCTAGATTCTCGGCTGCTCTACCAGCTCATTCGATTATGACAGTCGAGATCCTAGGCACTGAACTGACAAACACAATAGCC
GTTTAAGCACCATGCATGCTCAATTGATCAGTGTCAACTCACCGGTGAATAGTAGCTTATCCTGTTATCTCGAGCCCATATTTCACAAGAACTAACGTGC
ATTTATCACAATGTCAGCTGAAAGTGGTCGTCGCTTCCGACGTTCAAGGCTTCTTGATGACACTGACGAAGCCACTAGCAGCAGAGAAATATTTCTTGTT
AGCTTCGGCGACGCGAGCCTTCGCAGCTTCAGGGTTCATGAGCTCAATGCCCTGCACGGGCGTAAAAGCAAGACTTGATGCTAAACCAGAAAGCGGTGGC
TTAGCAGAGAACGCAGCAAAGTTGGCAGCGCGCAACTTTTTGCTTGACTGCTTCTGCTCCTTGCGCATAATACGCAGATTACCGGATCCTTCCTGACCAA
GACGGCCAGATGTAATTCCCATTGCGTTATCTCCGTACTCTTCGTCAGCCGTAGCGAATGACTGCCGGTTCATTTCACGTCGCACATCCGTCATCTGTAG
CCGCTCTTTCATCTTGCGATAACGCTTGCCACCACGTTTGCGGCGCGGCTTCTCGTCTGGAATAGGCAGCGCCTTCTTCGTCTTGGCCTTCTGGGGTTCC
TGCCATTTTTCCATCTTACCCACTAACTCGGTACGAAAGCGAGCGCCAACTAGCCCTTCCGTGTCATTCTGATGAGGTTGACTGTCCACGCGCGCCATCA
ACGCCAGCTTGCCTGCTACAGCTCTGCACGCCTTCATACGCAAATACGGTGGCACACTCTGCACCAGGTCGCTAAAGAATAGGACGCCGGTATGCTTGAG
TGCCGCAGCAGACGAAAAACCACTTAGGACTTTCTTATCTTGTCCTAAGACCTGCAAGTTGCACGACGGGATCCGTGCAAGTTGCGCCACACCGCCAGCA
AGTCCGATAAGCTGCGCAGCGATACGTGTGCCTACGAGCTGTGACACGTTAGGCGCCAAGTACTTCATGCGGCTTTCCACAAAACGCAGAATCATATTCT
TGTCCTTGTTCAGCGATAACAACTCGTTGCAAGCTTCCATGCAGATGTTCAAGTCTTCAGGACTCAAAGGTTTGCCACTAGTACCGGAACCCGTCACGGA
GATTCCAATAACAGCTGAGCTAGGAAGCAGTTTGGGCAGCTCTTCCACGAGTGTCAGATCCATCTCATTGCCGATAGCTTTGACCACGCGAGCGTAGTCC
AGTGCGTTAGGCACGAGGGAGTCGAGCTCCGGGAACTTGGCAGCGTAGACATCAGCGATGAAACGGTGTACGGCCTCTATCTCGTCATCGATCTGAACCA
TCAAGTCGTTGGACGTCACCACCAGTTCATACTCGGCACTTCCTTCCTCCAGTGGCTGGGGCTTGGTATTAGCAGAGGCATCGTCCACATCCACATATCG
CTGAATCTTCTGGACGTGCGATAGGTACTTGGACGAGCGCTTAAGCGACGCGACGGCAGCTACACCGCGCTGTTTCACGCTGGAGCGCAGCGAACCGGCC
AGATTTACGGTCTTTTCCTCTTCCTGGTCTTCACCCTCTCGCTTCCGCTTAGCTGGTCGAGATGGCGTGACTTGGGGCATCTGTTCGTCGACGCCATCGA
TACTATTTATCTCGGCGTTGACGGAGGAGGTAGATTCTACAGGGTTGGAGGAGCTCGTTGACGTTTCCTCTTCGTCACTGCTTCCGCTGAGTTCGTCTAG
GTCCTCCAGGAACGAGTCCGCAAGCGAAGACATGCTTTGCGAATTCTAAATGGAAATTATTGTTTTTCTAAATTTAAAGATGCAAATCTTGGAGATCTTG
CGATATCTATGGAAAGAAACGGACACAATATGCAGTTGGGCAGTTCTAGCTATTAAAATGATACACATACAAAGCTCAAGTAAACTGGCGAAACGGCACG
GTTGGAGGAAGGCGGTTTAACTTTCTGACGACGAAGCTTCAGTTCCGCATTCCTGTCCTGCCACGCACACACCCAAGTCGACTCTGAAGATCATGCCGGG
CCAAGAGAACACTAACAACGGAAGCAACAGCCAAAACTGGCGCCGCAAAACGCCTGCTGGTGGGCGCAAGGACAGCGACGCCGAGCACAAGAAGAAAAAA
CCGCGCCGTGGCGGTCGTCGCAACAACGGCAACAAGAACGCCAATACCAATGCCAATGATAACGTAAACGGCCAGACCAAGGAGGCGCCTGTCGCTGCGT
CTCCTGTAAAGCAGGAGGCTCCTGTCGAGGCTTCCAAGCCCGCGAACCTGGACTACTTGTCGGATGTTCTGTTTGCGTCGCTTGACATCTCGGCCAAGAC
CAAGCGCGCCATCGTGGACGATCTCAAATATGTACGCCTCACTAATGTACAGAACGAGACGTTCCCGCTGATTGTGGAGGGCAAGGACGTGCTGGCAAAG
GCCAAGACGGGCAACGGAAAGACAATCGCCTTCCTGCTGCCCGTGATCGAGAACATGGTCAAGGAAGGTCGTCGCTCCGGCGTCATCCCCACTTTGGCAA
TCTCTCCCACACGTGAGTTGGCTCTTCAGATCGCCACGGAGGCCAAGCGCCTCACGAAGTACCACGACTTCAACGTCGCTTGCTTCGTGGGCGGTGCCAA
TATCAAGAAGGATGAGCGCGCGCTCACCAGTAGCACGCCAATTGACATCCTGGTGGCCACACCCGGACGTCTAGTCGACCACTTGAAGCAGAACACTGGC
AAGATTGCCAACCGCCTGGGCAAGGCCAGTGTCTTGATTCTGGATGAAGCCGACCGACTGCTGGACATGGGTTTCCGCCCCGATGTCATGCGCATCATTG
GATATCTTCCCAAGGAGCGTCAGACGCTGCTGTTCAGCGCCACTTTGCCTGCCTCTACGGAGGAGCTCAAGCAGGTCGCTCTACGCAAAGACTACTCGTT
CGTGGACACAATCGACGAGAACGAGGCGGATACCAACGTCCAGACCGAGCAGGAGTACATCGTATGCAAGATGGGGGAAGTGATCCCGATGGTAGAGCGT
GTGTTGGCGGAGCACATGAAATTGGCAGCGTACAAGGTGATGCTGTTCTTCCCAACGGCTCGTTCGGCGCAATTCATGGCGCAGCTCTTCCAAGCGGCGG
GATACCCTGGTGTCCTCGAGATTCACTCGCGTAAGAGTCAAGCGGTGCGCACGAAGACCGCAGAGGCTTTCCGTAAGGGCAAGAAGGTAATGATGTTTTC
ATCGGACGTGTCGGCTCGTGGTGTGGACTACCCGGATGTGTCGCTCGTACTGCAAGTGGGTCTGACTGACCGTGACCAGTACATCCACCGTCTTGGACGT
ACGGCGCGTGCTGGTATGAAGGGAAAAGGTGTTCTTATCCTGACTGAGTTCGAGACGCCTTTGTTGGACAAGCTGGCGGATTTGCCTTTGTTACAAAGCA
AGAACCACTCTCCGGAGATGCTGGTGCCGTCGCAGTCGCGTGCATTGGAGGTCACCAAGAACCTCAAGAACTACAGTGACGTGGAGAAGTCAGCCCAGCA
GTCATACCAGGCGTGGCTCGGTTTCTACAACTCGCACGCGAGGCGTCTAAAACTTAAGTCTGTGGAACTCGTTCAGCTTGCTGCCGATTACAGCCGTAAT
ATCGGTCTGGACGAAGTGCCTAAGCTCGAGAAGAAGACCCTCAAGAAGATGAATCTCCTCGGCGTTCCCGGCATCGAGCCGTCGCCATACACGCGTGACA
ACGGCGGTAACCAAAATGGTGGCCGCAATGGTGGTGGGAACCGTGGCGGCTATGGTCGCAGATAAGGCATCAAGGTCGTGGCGAGACTTGAAAGACCAAG
TGATCCAACTCGAACTCTACGTCTCGGCAACTGAATTTTGTAGTGGAACGCCAGATGACTTCCTCATCATTAGAACCCAATCGTAATTTATTGCAACGAA
GGATGAGTCGGTTGACTGTAAAAAATAACTTTGCCTTATGCAGCCATGTCTATAACAGTAATTTTGCTTCACCGTTTGAAAAACGATGGACGAGCTGGCA
AAGACGTTAGAGGCGTACGCTGGCGGTCTGCAGCAATCGTTTGAGTCGGTCTCTGAGCGCGTGGGACAGAGTTTATCCCAGAGCGCGCATTTGATGCGCA
TGATGAACGAGGTGATGGAGTCAGCCATGCTACAGAACCTGTGGATATCCTCCGGTTACCAAGTCAAAGCAGGACTTATCATCGAGGTGAATAACCGGTC
GGAGATCATGCTGGGTCAGACGAAGATCCGTGCGCAACTGTACGGTTCAGAAAAAGCTTTCTTCTCTGCTACGCTTGAATCTCTCCGAGCTGGGGGGCAA
GTCCAACTGCAGGCACCGATTCATGACGCCCCCGGTCAGATTGCAGGATTTATCGAGCTGGAGTGTATCAGCCCAGGCACTCAACAACCACTTACTAAAC
GCTCACCGTTCCGAGTGTTTTACATCCAACTCGGCAGGTTTCAAGCTCTACTGAGCGGAGAGGAAGGAGCTGCTCCAGGTCCGACTGAAGTGGCGGTGGC
TTCGGACAGATTCTTGCTTGAAAGAATGCGAAACATTCTGGACCTCAGTCCAATCGACGGTATTTTGAAAGACGAACAGGGCAGGTATCGCTTCCACCCC
GAATTTCCGCTACGCAACAACCCTGTGCTTTATCTCTCCGTGAAGACGGGGGGAGCAGGTGACCCAGCATTTCAAGTCACGGTGTCTGCTGCAGGAAGTG
CCCACACCGCTGAAGATCGTCGACGTCAGTGCCAGCAGATAATCAACGAGTTGGAGATCGACGACGCCGACGATTCAGACTACTACAGTAAATGACCACT
CATTAACAATAATGATGCATGCGCCGTAAGCTGTGATACAAAAAAATGTTTCGGTATTATGAGTCTCTATCGCCATTTTATATGGCTCTCTGCTACGCTT
GAAGGTCCCTCTGTCAGCTGCAAAGACAGCAAAACTATGCACCGGTACTGTAGTTCCATGCTGCCTTGTATTTAAGCTACACGATTACGCCCACTGGCGC
TTGGAGAGGTAGCCGCGATCGCTAAACCACTTATGTAGTAAGAAAGACTGGCCGCCGTACATGGCGCCCAATACGACGAGCTCGAACATCGTGTAGTAGA
TGATGCGCGACTTACTGCTCTCAAGTGCTACAACACCCCAAGCCAAGCAATCATTAGTGAAGATACTCGGGCAATTCAACCACGTTTGTACTTACTCTGA
ACGTGGCGGTGTACTCGGGCACGGTAGTAGTCCTGCTCATTACGAATAAGCTTCAGCAACGTCTGCAATCGATCTAGCGACGTCTTCACACCTTCCACGT
GCTCTATTATCACCAGCAAGCACAAGCCACACGCAAGTACGTCAGGGAAGTGTCCCAATTTTTACCTCTCCAAAAACACCACCCACCTTTACGAGTCTGC
TCGTCTACTTTGTCTTCCTCGCCCAGTTCGTCCTCGTTCGACAGGTCGAAGGACGTGTACCACTCGACCATCTTCGTGCTACCGTCGTGCATGTTGCCAA
GACAGAAGCGATACCATCCGCCACGGTGCTCGGACTCAAAGTTGAAGCCACTGTGTTCGACGTTCTGGTTGGTCTCATCATACGGCGTTGCTACAAGGTG
GTCGAAGAAGTTCTTGTCCACCTGCTCCTCTTCCGGATATGAGGGGAACGGGCCGTACGCCTTCAGTCGGACGTCGTAGGTACCCTTCGACTCCAGCACG
CCGATCTTCATGAAGGCCGTGCGCTTGGTACGCACGTACTCATGAAAGCATTCCTCCACGCGCCCATCCAGCTTCACGATCATGGCGTCCGAGGGAGTGG
GTGCCGCTACCAGCACTGCGACAGATGCTGCCACCACACGCAGTAGTCGTACGAGCGCCATCGTCAGTGCTGCTGTTCAGGTCGTCGACAATCAGCTCCC
AGAAATAAGATCGATTGACGCGCCCACAGTCACTATTATTAGCCAATCTCTGTCACCGTAGATATTTCACCTTTCCAAATTACCTGTACCATTTTCCAGG
TACCCATGCAAGGCTATTTTGGGGTCAAGCAACTGCCAACCAATTAAGCAGAACCAATGTGGACGTGTCGCCGTCTCTCGTCGCACTTGTCGACCACTGC
TCGCGGTTTCCGCTCGAGCTGCATCCCATGGGCGTCAACAGGTAGTCACTTGTCGGACGTTTCGTTCGCTTCGCTGCCAATCAGCCAGAGGTCCAAGGAT
GTTCTCACGCGCGACATGGGCTACGAGTTTCTAACGCACGTGCAGAATGACACATTACCGCTGGTGCTGGATGGGCGAGACGTGCTGGCCAAGGGCAAGA
CGGGCAACGGTAAAACCATCGCCTTCTTGTTGCCAACGCTAGAGCGAATGTTAACGCATCCGCAGCCCAAGCAGGACAAGATTTCAGCGCTAGTAATATC
TCCTACCCGAGAGCTGGCACAGCAGATAGCAGTCGAAGCGGTGAAGCTCACAAACGCCCATGGACTGCGCACATCCTGCTTTGTTGGAGGCAGTGCAGTT
AACAAGGACGTGAAGGAGCTGACCCAGTCCGGAGGGATCGACGTGCTGGTATCCACTCCAGGAAGACTACAAGCGCATCTAGAGGACAACAGCGGACGTA
TCCGACAGAAACTTGACAGCCTCCAGGTTTTGGTATTAGATGAAGCTGATCGTCTACTAGACATGGGTTTTCGTCCCGACATTATGCGAATCATCAGTCA
TTTACCGAAAGAGCGACAGACACTGCTCTTTAGTGCGACGCTGCCTGCTGCAACCGAGGAGCTCAAGGATGTGGCTCTGCTGGACGACTATGTCTTTGTG
GATACCATTGAAGGCGATGATCAACAAACCAACACTCAGGCTGTACAGGAGTACGTTGTGTGCGATCTCCAAGACGTCATTCCAGTGGTGGAAGGCATTT
TAGAAGAGCACATGAAGCTGCCGGCGTATAAGGTCATTGTTTTTCTGCCGACTGCACGGTCAGCACAGTTCATGGCGCAGCTATTCCAGTCTGCGGGTTT
CCAGAACGTTTTGGAGATGCATTCGCGCAAGAGTCAATCTGCACGAACAAAGGCTGCTGACGCTTTCCGCAAGGGTAAGAAGATGATCATGTTCTCGTCA
GATGTGTCGGCACGTGGCGTCGACTACCCAGACGTCTCACTTGTTTTGCAAGTGGGTCTCACGGATCGTGACCAGTATATTCATCGACTAGGACGCACCG
CCCGTGCGGGTATGGAAGGACGTGGCATTCTAGTGCTGGCAGACTTCGAAAAGGTGATGCTTCGTGATCTAGCCGACCTGCCACTTACAGAACTAGAGCA
ACGTCCTCAGCTGGACCAGCAGAACTACCGAACCACTCGTGCTCTCGCAAATGTACGTCAACGCAGTGAATTGGAGCAATCAGCAGAGAAGGCTTATGCT
GCCTTCCTGGGCTTCTACAATTCAAACCTTAAGAAGCTGAAGATGTCGAAAACGAAGCTTGTTGAGACGGGAGCTCTCTATAGCCAGCTGATTGGACTGG
AAAAGGTGCCGTCACTGCAAAAGAAGACACTGCGAGCGATGGGGTTAATGGACACTCCGGGCCTTACTATCGCTTCCAAACCGGTTAGAGGAAGAGAGTC
TAAGGCGAAAGGACAAGGAGAACTGGACAGATTCGGCAGTGAGAATCGGAATGGCTATCAATCGCTTCATAGCCGAAAGAAAAAGGTTGATCGCAGCAGC
AGCTTGTGGAGATCGTACAACGACAAAGAAGCCAAGCCTTTTCAAAGCGAGCAGTCTTTCAAGAGTAACAGGAGTCGAAGCGCCTCACCAAGTACGAAAC
GTGAAAGTCGCTCCCATGGACACAAACGCTCTGCGAGCTCGGCAACCAAGCGGAATTACAAGGAGCCGCACAAGAGATACTACAAGAATGATAGATAGAT
AAGCGGGTTATCTTCTGCTGTCGATGGCTATGTCATACCTGAGGCTGTCAGGGCCAGCAGCAACAACGATAAAACACGCAAAGTTCTTCACGAAAATCAT
ATATACCTAAGGAATGGACTGGTACCTGGATCGCTGATGATGCTGGACAGCGAACCAAGTAGCGGAAGCACCGACAACGGCCCCGATGACAGCTCCAATA
CCAAGTTGAGCGATTGAAATAGTGCTCGAAGATGAAGCACTGACGCCAGCAGAAGGCTGCACTTCAAGGTTGGCACTGACATTCTGCCGACTTTCAAACA
GCTCAAACTGTTTTTTCAGCTTTGGGATGTGTGGGGGCACCAACGTGTCGCCTGGCCACTTGGAGAACTCGCTGAGTCTGAGCCACCATTCTGGATAACC
AGGCATCTTCATTTCCTCAGGAGCTTCGCCCGTGGTGATGTAGCCGTCTGCGTATTTGCCCACAAGTTTCCATGCAAACGCCCACCACTCGTCAACGACT
CGTGAAGCCAATCGATTTGATTGCTCTTGTAGATACGCGCGTACGTCCGCTGGCGTCAAATCCTTTGTGTCGGTAACATGACGCTCCATCGTTTTCCGCT
CAGTGAAGCAAGCTTTTTGCAACTCAGTCAAGCGAGCTCGGATGTCCCTGCTAATGGCATCAAAGCGCAACATGCTCCAGTTGTTAACGAAGGCAAAAGC
CCACCAAGCGGACTTGTGTGTAAACTCGCTTTCCTTGCCGAGGACGTATGCGGACGGAACTTCTTGCTGCGCACACGAGAACGGCACATATACCGAGGCA
TGCGGTGAACTCTGTCCGTACCAGGCCACACCACCAACCTCATCCGGAAGGTGAGCACGCGCTTGCAGAACGAAACTGAACACTGTGCGATACATGGAAA
TGGGTCGTTCCCAACCTCCTACGACACCTTTTTCATCGCCTCCCCACCGCATTGGGTTTCCGAACGGTCCTGCCGCTAATCCTTTGGTCAAGTCGTATGA
CGTGCCTTGATAATAGTCACGCAGTAAATGCGTCACGTCCGCTACGTCGAGGTTACGGTCTGGTTCAACTGAGAACGGATATGTCGGATATTTGGGGTAG
TGTCCAAGTCGAGAGTCTAGCTGCAAGGACGGCGCCACGAGATCAAACACACGCCAAATACGACGACCCATATACAGCGCGCGCACGGGATCTGGCGTTT
GGGAGGCGTATGCAGCGGTGAAGTCGAATTTGCCTTGCTCGGGGTCCCACCACCCCATCTCTTTAGCGAAAGAAAACACATTGCCAGACGCCATGAAGCG
CTCTGGATCATCCAGATCCATTTCACGGATCACGAAGCCATTAGCCACCACGACTAGGTGATTATCATGCACGCGTTGGGCTGCCCATACAGCGCTAGCG
TTCTGCGGACCCGTCAAGACGTGGAAAACCCACACTTCTCCGTATCGATCAGCAATGCCCAGTGTCTCCGCTGCACTCACGTAGTCTGGGTTGGCTGGGT
CTCCACTGTCTTCACTGTAGAATCCATACTGGACGGCCAGATCGCCCATCAACTGGATTGCACAACGAGCCGAGTCGCAGCGCTCCAAAGCAACTTTGGT
TAGCTCTCCGATGCCGAACATGTTGTATCCGTGCGGACCCGCGTCTGTGGGCCAGCCAGCTGTCCTGGCTCCGCTTGTACTCTCTCCAATACTGAGCTGC
ACTTCGTTCATGAAGCCGTAGTCCTGGTCGAAGTAGCCGTAGGTGTGTGGTACCTCTGGGATCTCACCGAGAGGCGTCATGAGCTGCTCCTGGTCACTCT
TGGGTTCGTACTCGGGCCCTCGCTGACTCGATACAAGGCGTGGGTAGCCTGGCTGCACATTGTAGACGTGCCGCATCGCTCCTTCCTCGTGGCTCTGGGC
TGGTACACGCACCATCCGCAGGTCGGCGGCGCCGAAGCCCGCGTCATCGGTGTGAGCCACCAAAGTTGAACCGTCAACAGTTGCGTTCCGCCCCACCGCG
ATCATCGTGCACGCTCTCGCCAGCGGTAGCAACATAAGTAGGAGCAGGTACATGATGACTCGTCGACGTAAAGATTAAATCAATGGCCTTGTGCTGCGGG
GAATGAGAAACTTGAAGTGGTGCCGGCGATCCTTTTTGCATTCACCGGTCGGATTTGAGAAAAGAACGATTTGCAGAGCAAGTTTTGACTGATTCTGTAT
AAATAATATTGCTTGAGTTAAAAGACCTGTCATAAAATACTAAACGTGGATGGACACTTAGGCCATTAGGCGGGGACGGATAGAGCCGATGGCCGTGTAC
GGCAGGGCGCTGGACAGCGACAGCTCGCGGATGGAAGGCAGCTTGTAGCCACTGATCAGTTTGCGGGTGGGGGACAGGTCAGGCAGGCTGAACACAGGTG
CCGGGTGCATTGGCGGGGACACGATCCGAGGTTGGTACGACAGGGCTGCAGCCATGGTGGTAGTGGTGCCGGGGCGAGGAAGAATCGGTTTGCACTTCTC
AACACCGTAGTTGGCCACGGCCAGGGCCGCACGCTTGGCTGGCTGCTGCTCCTCGTCTGCAGCTTTGCGCTTGCGCGACTTCTTGCTCTGACGCTTCACT
AGCGACATCTCACTGAAGTTGTCGCGTGTGAAGTGCTCACGGCTGTATGTGGGGAACTGCGCACGAGCCTTGCTCCATTTTCGGAAGCCGAAGTAGTTGA
GCTGGCGCTGGAAGCTCGAGAAGTTCTTGTTCTTAAAGTACTTGGGCAGAATGTGCGTGGTCATGGCCTCCTTGTCAAGGATCTGAAAAGCCATGCCGTC
TTCGGACCAGCGGATGACGCGAGGGTCCTCGCGTCGCAGCATCTGATGCAGATGCAGTAGGAATGGCGCCACCCAGCCGCGCTTCGGGGTGTCCGAGCTA
CAACTATCGACTGATGTCGCGGGCGACGGCGGGCACTCGGGCGCTGCCTCGCTGGAAAGAAGGTCTTGTACGTTCATTGATAACAGATAAGAGCTGCTTG
CGCTTCACTGAGCGAAATCGGAAATGAGACTGGCGCGAGAGCGCGTTTCTTGACAACCCAAGTAGGCATACTGAATCCTTATAGTTTTTCTTTTTTTGAA
TCTGGATTCGACTAACAACCAACACGAAGATATAGTATTGCAGTCACCTCACGCGAATCTTACAAGGGGTGGGGCAGGGACTTCGTGGAGCGGCTTTAAG
AACGGCATGAACTGTAGGCAATATCTTCATAAAGGCCGATGCCCATGAACCGTGAAGCTTTCTTTAGCACCAGATCCTCTGCTGCCTCCGAGTACGAATG
TGCCAACTATTCTTACCTGGAACTGTAAACTACTACAGTACAAAACGATCTCTTCGTGGGTTCTTTATGATGCGGAGGTTTTCAGACCAGATTTGCCTTT
GCGAATCGCAAGTTGCGATGGGAGATTCTCCAGTTGTTAGATTCACCAATGAAACCTGAGTTTTGTATTGCCTGACGAATCTCTGGCCTGCAGAATTCCG
GTCGTTTCAACGAGAAACCATTTTCTTTGCTTTCCCAAGAGACAACTGCGTGTTGCAGTCAAAACGCCGTTTCCTTTTTTATTCTCTAAATAAAAGGTCA
AAATGAACGAAAGATACAGCAACAAACTGACACAGGCGACAATAATGTTAAATGTGGCAATCTCACAAGTACTACTGTAGCTGTGAATCAGACGAGCGAT
CTTCAAACGACGCCAGCTCGCATCATGAAGATTCGCGTACCAGTACGCTTCCTGATCGGTGCGCTGTTGGGCTAGACTCGGTCTGATGAAGATTCTAGCT
GCAGCTGACTTCTTTTCCACCCGTAGGCAACGTGTGTAGCTTCTCATCGCTGGCGCTGCTTCTGGCTGCATGCAGTGGCCACAAATGGGCACGAGACGCC
GTCAACTCTGTGGATATCGGACTTTGGCACCTCACGGTGCGAGCAACGACAATGAATCTCTACTCCTACGCGTACTGAAGCTCTTGATTCAGGGTACAGG
CGTGCGCTACAAACTCGTTAACGCTGGCGCCGAGATCGAAAGCACGGAGACAGACCAACCTGCCACGCGTTACAGTCATTTCTGGTAGTGTATGGCTTTA
TTTTTTGTGATTGAAGCTTTCGGCCGTGCAAACTGACGATCGGTCGAGCAGATCGCTGCCTCTAGCGACCCGTGGTGTCTGGGCGATGCCACCGGCACGA
GGTTTTTTACCGTATTGGCGCTGATGGCCGCCATGGTCAGCTTCTTAGTAAGCATCATGGTGACATTCAGCATCAAGATTCCCGCGTGGAACGGGGAAGG
CGAAGAGCCCACGCTGGTTACTCCAATAGTGTGCTCACTGGTTGAGACTGTGTCGCTGATCCCTGCCGTAACGCTGTGGCAGCGCATGGTGAACGTCTAC
GACGAGCAATGTCGTGAAACGATGCACATCAATACCTTCACATGCATCGAGATGGGCCCCACACATTCGTACGCCATAGCTGCTATTCCATTTGCTGCAG
CTACCTACTGGCTGTGGCGGCTTTCGCATTGTTACCATGTGAGTCTCCCTTTCCACACAATCGAACATGCCTTGACTCCTACGCTTTACATTGCAATAGG
AGGCTAAACAAGCTGGCAGGATTGCCGATGGGTTTACACTAGCTGCGAAAACAGGCAAGAGTCATCGTGTACATGCTACGCCATTGCTTGAACAGTGATG
AATAGTGTTAATGATATAACCTCATGCAGACAATGTGGACGAGATCCTTTCGGGAATCGCCAATAAGATTGATATTGATGCTAATGGATCCGACGGTAGA
AATGCACTGCATTGGGCTTGCACGTTGCACCGAGCAAGTATTTGCCATGTCTTACTTAAGAAAGGGGCATCGATCAGTAAGAAAGATGTAAGTCGGCATG
GAGGTGGTACAGTAGTTCCAACCTGGAATTCGCAGATTGCTTGGCTTACAGTAGCGTTGTTCATGTACCAGAGAGATGGCTGGACACCTCTACATTGGGC
AAGTCGGGTTGGTAACTTGGATATCGTGCGCCTTCTAGCCAAATACGGTGCCAACTTGAATGTCCAAGATCGATGGGGTACGACTCCGTTAATACTGACG
GTCATCGGTGAAAGCAAGGTTGCAGCGGAAACGCTAATCGAATTAGGTGCTTCAGTCGATGCACGGAATGTGGGTTTGCAGCATGTTTTTTAATGGGGAG
TCGATTCCAACCATGGGGTTCTGTACTCGAGCAGGTATTTGGACAGACACCACTGATGCTGTGTGCGGAAGGAGGGACTTCTCTCCACCAGCTAGGCATG
GTATTTTTGAATGCTGGCTCAAATCTTACGTTGCAAGATGTATGGACATGTAAAATGGGAAGTTCTTAAAAAGAATGGCTACTAAAACATATTTGGTATC
GCAGGCACAAGGCATGACGGCGTTGCACTATGCGGCTGCCTGCGGAAGTGTCAATCTTTTGATGAACATGCTCCAGCAGTGTGATGCTGATTTGGTCGAT
AAACCAAACAAGGTGAGCAGTACCAACAAATGACGAATTATTGACAGCTAACTCGAATCTGTTCAAACCAGTTCGGGGAGACGCTGTCATACCTTGCTGT
TCTGCATTCACACACAAAAATACTGGACCTGGTCAAGAATTGGCGCGAAGGAAACCCCATCGTTGCATATCACGAGAATGACGAAGATGATAGTGAGGCC
CAGGACAGTACAGACTCGTTCGAAGACGATGATAGCTACGATAGCAGCGAGGAGGACGATTGAATGAAGTCATGCACTGTTAACAACCACTGTAGTAAAA
AGCTTTTGGATCTATAAAGTTTGAGCCTACCTCCTCTCTATTGGAGCTTCTCAAGAAGTAATTTAGTGCCCTTCTGCTTGTCGGCGAGTTTGTTCAGCTC
TCCCATCACTGGTTTCAGAGCATTCTTCACCACCTTGGTAGCGTTCTTGGGGACGTTCTCAGCCTCCAGGAATGCGAGCACCACAAATGAACCCCGGTTG
CTTGTCGCCCACTGCGGAAACTGCTCTTCGACAGCCGCAAGCAGAGGTTCCGCCAGCGAGGTTTCCTTGATCAGACGACGCAAAGCGTAGTGTCCGTTTG
CATCACTGTGGAGCGGCTCCGTTTCCTCATCAGAAGGCTCCGCCACAACAGCGGCCGCAACGCTGTCTGCCAGATCCGAGTTCTCGCTCCGTTTAGCGAC
CTCGACAATTACATCACGGCCTTCCTTCGAGCGCATCAAAGCTTCAGCGTTCCCAGCACACATCTCTTCCAGCTTGGGTTGCAGACCCTTCAGCAGCTCC
TCACGACGAGCGTCCGGGTCCTTCTTGTAGTTGACCACCATGACGGTCGGATCCTCCGGCGACGGCAGCATGGGTGGCTCCAGCAGCGCTAGATCGTCTG
CCGAGAGGTATTTTTTGTTCAGAGGGCTAAGCAGCTGCAGCAAAATCTTGCGTCCACTCGGGTGCATCGCAATCGAGAAGAGCTCGTCGTTCATCTCGGC
CAAAATGGACTTTTGCACCAGTACGGAGTCGTCCACTACATCGAAGATGCGCATGATCACGAGGTAGCCACTGGGGTGGTTGCAAGCGTCCAGCACCTTA
TCCTTTAGAGCCTTTATAATACGCTTACGGTCCTTGGCCGCACCGAGCGAAATGCACTTGTTCACCACACGAGCACCGTTGCGTGTGGCAAGCAGCGCCA
GCGACGCGTCACGCACGTTGGCTACCATATGCATCACGTCGTCGTGCTCTGCGTTGCACATGTACTCCCACAGCAAAGACTGCACGAACGCCAGACCGAG
AAGTTGCTTGTCCACCATGCGATTCAAGATGGTGGTCAGATGCTTGAGCACATCGGCCTTCTTGTCCGGGTGTGCGGCAATAATGTCTGCAAGGTTGCGC
TTGCTCTCCGACTGAAAGTAGGCAAACTCACGGCCGTAGAACTCCAGCTTGAGCGCTGTGAGTTGCGACGGCTTGAGATATTCCTGTGCGTACTCGATAA
CGTTGGCTGCAATGTTGTGCGTGCCGATCTGCACGACGTGACCTGTGAGGCACTTCACGATGGCGGTGCGGTCGGCCACGCTGCCGTAACGAATCATCTT
CTGCACGAGGAAGCAGCCGTATTGCATCTTGCATACTTCGACAAGGTGCTCATTCATCTCGAGCACGATCTGCGAGCGGTGCTCGGGCTTGCCGTGCTGC
ATGAGCGACTGGATGACTCGCGAGGCGTCGTGCTTGGCAGCCACGTCGTAGATCTTGCCCTTAACCAGCGTGTAGAGCTCGTCCACGAGCGTGGCACGCT
TGTTCTTGTCTACATCACGCTCACGGATAACGTTCCAAATCTGCTTGGCGCGCGTGACCATCTCGTAGTGCGGGCGCTGCATCTTGCGCTGCTTCTTGGC
GAGTTTCTGGTCCATGAACGACTTCTTGCCGTCCTCACCATTGCCGCTAGCAGGGCGCTTCTTAGCGTTAAAGCCGCCTTTGCCGCTGTTGTAGCTCTTG
TTGCCCTTGGGCGTTGACGTCTTCGCTTGCACCGCCATGTCTATCACTGCAATGTCGAGCTCGCCAAGCTTGCGCCAACCAGTCAATACCAATTGGTCGA
GACATATCACAAATCAACAGAGCCTTTTTCACAAAACTTTATCACAAAGAATTAAATCACAAAGTACCAATATCACAAAAGGGTGTACAAATATGTATAA
AATTACTTTTTAAAATGTCGCAAAAGCGGTCAGATCATATAATGTGATTCCGACCACGATCTTGAAGCGCCGCGTCCGTTCAATGGCAAAGATCTAAGCG
GAACTAAGAGGCAATCTTAAAGCATGGCCTTGTTCTACGACTACAATGTGGCGGTGCCGGCCAACCTACGCCAGATCTGCTCAGTCTGGGGAGAGCTGGA
CCCCGTGCTTGCCGTCGCATTGGAGAATCGAGAAATCCATTTTTTCACCGATGAGGTTTGACTTGTAGCAAATACTGCTAATCGAGGTACAAGCGCGAGT
GATAATGAGTTCAATGCTGATCGCTGCAGGGCGATAAGCAACAGGGACTGGAGAGCTACTCGCGTAGTGCCGATATCGTCACCATGGCCTGGCAGCCTCG
TGGTGGGGCACTTGCAGTAGGCTGGAGCGACGGTACGTCATCTGCATAGGCCACTCAACTTACTATCTTGACTGCTAACCTGACTGTTTTATTGTAGGTA
TGGTGTCTCTATGGGTGTTTAATGAGCAGGCAGCGCGCGAGGTGAACTCCCCACACACAAGCCGCGTTTGCCTGTTGAAATGGGCTCCAGCAGGCAACCG
ACTCATGTCTGCGGACGAGAACGGAGTATTCGCAGTCTGGAAAGTGGACAGTCGTTGCCAGCTCACGCTCAGCACGCAATATGCACGCCAAGGTAGCCTC
ACCCATTGCGTATTTGCCACTCGACCCACTCTGTCGAAGGACAGTAACACCAAACCGTGAGTATCTTATTGCATTGTTGTCCATTCATGCTCGTTGCATC
TGATTCATTTTAACATATTCAGCGACCACTTTGCTCAACATTCCTGTCCGCAATTCTTTTTCGGCGGTGCAGTGGGATCTGTGCACTATGCTGACGACCT
GGGACATATCTCGGACATTCAAGTTCTGAATCATGCGATCGAGTCGATGATGTTTTACGAAGAACAGAACCGCCTGCTTGTCATCACGCGGGCAGTGCAG
CTTATTGTGTACCAAATAGGAGCGACGGATGGCACGGTGAAGCCAATAACTAAGGTCAAACTGAGTCTCGCGGGAGAAGGATCTTTGCTTGAAAGCAAGT
GGGCTAGTCCAGGGCTACTAGCTATTGCGTCCGGCGAACCTTTAGTGCGCTTTTGGAACATTCGCACGGAAGAGAACAGCGTCTTGAGCTTACCAAAGTC
GAGTGGACTCAACTACAACGTCAACAATTTGAGTTTCTCCCCACGAAGGCGTGTCCTCGTGGCTGGTACGGCTCAAGGAGCAGTGTTTTTCTGGCGCGCC
ACGTCCTTTATTGACAGCATTGCGCAGGGTAACGCTGACCCTGCGAATGTTTCATATCGTTGGGACCTTCTGTTTACGGCCGAGGTGGGCCGAGCAGTCA
CACGTCTTGGATGGAGCAATGCACACCCTGCCTTATACGCCAATACTGTCGAAGGTGTCGTCATTTTGCATGAAGGCAACATGCAGCGTGCACTCTGTGG
AGATACCGCAGTAATTCAAGTACGACCCAAGACCCTTTCAATTGAAAAATTCCAAGATGGAGTGCAGTCTGGCGTGACTATCACGCAGTCGATGCTAGAG
GCATCACTGCGTGTTAAGGGTATTTCGCACGACGGGTCAACACTTGTGATTTGGAACGGCTCGAAAGCAGAAGTGTACGAGATGAAGGATGGCGATGCTA
AGATGATCAACCAGTTCAAATGTTTCTCCAGTTCTATGGTGCTAAGAGGTGAATCCATCTACCGTGCGAATGGGAACCACGTCGAAGTGTGCAATCTTGC
AGGAGTCGTAAAAAACACTATCTCGTTCACAGAAGCAGAGGGCCGACCAGCGATGCTGTCACTTCAAAATAAGTTTCTCGCAGTGGGTACAGATCGTGGT
CTTCTGCGTGTGTTCGACGTGTCACGTCGTGATCCAAAAGCTCTCGGAAGTATGGGCAACCTCCCCGAAGCTTTTGATGAAGAGACAAAATGCACCGTGA
TGCGCGCCATTTGTGTCAACTCAGACGGCACACGTATCTGCATTTTAGCTGACCGAGTCGAAGGCGGCTTGTGCATGCGAGAGCCGTCGAACAAGCTCTA
TTTGTTCCAAACGGACCTCAATATCTACCAACAATTCGACTTTGGATCTTCACGATACCCAGTTTCCGTCTTCTTTGACCCTCAAGAACCACGCTTGCTT
GTTTGCGAGACGGTTAAGACTGGCAACGATAACTTGTCGACCGCAGCAGGTGGCGTTAGTCGTCGGGACTTAAATTCCGACGACGGACTCGGAGCCGGCG
TTGCAGGTGGCAACCGAGGAAGCCAAGTCTCGGACAAGGAGATCACGATCATTTTTGCGTCAAACGAGCACGGTCTTCTCATGCAAGATAGCTTCGATCT
TGAGCTAAAGTACACGGCGTTGCTCGGTATTCAAGTTCCACGTGTGTATTTCGTAGCGAAAGTGGACAGTAGCTCTTCGGATGACTCCACTACTGTGGTG
CACGTTGGTCGAACAAAGACCAACAATCCAATGACGAAAACCCCGACAGTCTACGATACTGTAAGCTACTTGCGAACGCAGATCATGCGTGACTTCACAG
GCCTGGACAAGGTCAATAACGAGGCCAAGCAAGCTTTAATCGACTTCTGCTACTTTATGACGGTCGGCAATATGGACGAGGCTTATCGCTCGGTAAAACT
CATTGAGAACCCGTCTGTTTGGGAGAATATGGCTCGCATGTGTGTCAAGACAAAGCGCTTAGATGTGGCTGAAGTTTGTCTTGGGAATATGGGTCATGCT
CGAGGTGCAGCTGCCGTGCAAGAAGCCAAGAAGGAACCGGAAGTTGAAGTGGCGATTGCCATGGTAGCGATCCAACTGGGACTGCGTGATGATGCAGCGA
GACTTTACCGCGAGTGTGGGCGTTACGACCTAGTTAATAAACTATACCAAGCATGTGGATACTGGAAAAAAGCAGTAGACGTAGCAACCAAACGCGATCG
TATTCATCTCAAGGCGACGTACCATGCGCTTGCACGGCACTACGAAGAAATGGGCGATCTCAAGGAGGCCATGGAGGCCTACGAAGATGCTGGTACTCAT
CAGAAAGACATCCCACGAATGCTATTTAAGTTAGGGAAGGTCGATCTTCTGCAGAAGTACGTTGCTACCTCTAGTAATCGCGACCTATTGATCTGGTGGG
CGCAATTTCAAGAGAGTCAAGGTCAATTCGATGCGGCAGTGGAGAGTTACCAGCGTGCCAAGGACTATCTGTCCATTGTTCGCGTCTTGTGCTTCAAGAA
GGACTTCCAGGCTGCTGCCAAAGTGGCACAGACAAGTGGGAATCGCGCAGCAGCTTACCATTTGGCCCGACAATTTGAAGCACACAACGAGGTTTCCAAC
GCGATCCACTTCTTCGCAAGTGGTGGCTGCTACAACCACGCGATTCGTCTTGCCAAGGAGCACCGCATGGATGCTGATCTCATGGGCTTTGCCCTGATGA
GCAAACCAAACGACATGCTTGACTGTGCTGCGTACTTTGAAGAACAGCGCGAAATGGAGAAGGCAGTCCAGCTCTACCACAAAGGAGGCAATGTGGCTAA
AGCTCTGGACTTGTGCTTTCAAGCGCAACTTTTCGACGAGCTGCATCACCTCACGGACGAACTTAGCGGCTCTGGCAATACGTCGCCAGCGATTCTCAAG
AAATGCGCAGACTTTTTCATCGCGAATGGACACTACGCTAAGGCTGTGCACTTGTGTTTGATCGGAAACCGATTGGCTGAGGCATTGGACGTGTGCATGC
AGCAGGATGTAAAGGTTACAGATGAGATGGCCGAGAAGATGACTCCACCTAAAGGTGATGGCAGCACGGCGCCTGCAGACAAAAAGAGACGCACGGAGTT
ACTTCTCAAGCTTGCCAAATGTTGCAAACAACAAGGTTCATATCATTTGGCAACGAAGAAATACACCCAAGCTGGCAACAAACTCAAAGCTATGAAGTGT
CTACTCAAGTCGGGAGACACTGAAAAGGTTGTATTCTTCGCCAATGTGTCGCGCAATGCTCAAATATTCGTTCTCGCGGCCAACTACTTGCAGAATCTGG
ATTGGCGCAATGACACCGAGATCCTTAAGAATATTGTGGTATTCTACACCAAAGCTCGTGCGTTTGAGCAGCTAGCAGCGTTCTATGCTGGCTGTGCTCA
GGTTGAGATTGAGGAGTATCGCGACTATGAGAAGGCAATTTCGGCGTTGCAAGAAGCTGTACAGGTGGTGTCCAAGTCTCGTGCAGACGGCAAGGACGCA
CTGCTAAAGCGCTATGAGAAACGCATTCTACTTATTGAACAATTCACTGTGGCCCGTCAACAGGCTAAGCACAACCCGAAGGAGACGATGGACATGGTCA
CGAAATTGCTGGAGGAGCCTGGAATCGAGGAAGCTATTCGTGTCGGTGACGGGTATGCAATGCTGGTTGAAGGGTATTATGAGGAAGGTGAGCTGAACAA
GAGCTTAGAGACGATGGAGGAGATGAAGCGAAAGGGACTCACGCTCAAGTCGTACGTGGACCCTCGAGTTGTGGAGGCTGTTCAAGCGAAGCTAGGCGTT
TCGCTGGGGGACGACAGGCGCCGTAGACCTTCACCAAGCGACTACAAGCAGGGGAGTTCCTCTAGCCGTCCTGACTCGCGTGAAGCCAAACCTGGTCAAC
CAACAAGTCGTCCTGTTTCGAGAGAGGCGCATAGTATCCGCCCAGGTTCTCGTGGGGCTGCAATGAGTCGCCCCAACTCACGCGAGGACAAAATGGGAGA
CGACGAGGTCGAAGACGAAATGGAAGAAGACATCGCTGAGGACGAGTAGGCAACAGCGATATCAAGCACGTTTTAGGTTAAGCATTATGAACCTCAACAT
TTTTTTTCTTCATTTTTAAAGTGACAGTCCCTATTCAGATGACAAGAAGATGCAATTTTCAAGCCACGAAACGGCGGTCGTTTCCAGTGGAAGTTCCACG
TCTGAAAACGCGAGGTCATGCCAAGACCTTTACTGCCTGACAACGTCATCTCTCCACCGACCAACACACAGCTATCGAAAGACCCAACCTGTTCATCGAT
TTTTTACGATGACTTGCTCACCTCCATGACGCCGTATCTTACCTGTCAGCGTTGCAACAGCGTGGCGTTCGTCGATCTGAAGCGGGTACGGCGTAAAGCG
GATCAACTGACTACTTCCAAGGCTGGCGATAGAAAAGACACCACCTTTCTGTACGAGCAAGTCCCGAAGTGTCCTGTTTGTGGTAGCACAAGATATCTGC
GAGCCGGAGTTGTAAGCTTCCAGGAGCAGATCGAGGAGGAGCGAAATGCCATCAAGGAATTTGAACGTCGACGAGTTCCAGCCACCGCTTTGCTACAACG
AATTGCCCGCGGTTTCCTTGGGCGGTTGGAGTTCCGTCGTCGATTAGTCGAGCGTGAGCGATATCTACGAAAGATCAAACGTGCGGCAACAAAAATTCAG
ACACGGGTACGAGGAATGCAGGCACGAAGGCGAACTGTCATCGAGCGATGTCTACGGATTATTCGCTTTATGGCTCCACAGATTCTTAGCTACGCGCTAG
CTGCCCGACAGAACGTGCCACTAGTTTTTTGGTACTCAAATGCAGCAGAATTAAGTGTGTTTTATTGGAACTACCGAGAGTACGTACGGCGTTCGGGTGG
GAAACCTTCTTTGATCAAGGTGGAGAACAATGTAGTGGAGATAACGAGACGCGTGCTGCGTCGCGAATACGCGCTTGTCAGTCGCATTCAAGCACAATGG
CGGGGACTAGCCACGCGTATGGTCTTCCGTGACTTCAAGAGACAGAAAGGGTGGCTGAAGGGTATTCAGCAGTCTCCAGCTGTGAAAATTCAGCGACTAG
TTCGTGGTGTTGCAAGTCGTCGTCGTTGCCAAGCATTGCAAGTGACCACCAAGTACCCAGCTCAACGTGAAGCCTATCGCAAGGAAATGACAGCCCGGGC
ACAGCAGTCGAAGGCATTAGTCTTCCGCCAGCGTCTGATGGCCAAGTACCAACAACAATTCCAGATCAATCGCACCACGCGGATGATCGTGCAGACAGTC
AAGAAGCCATTGACAGCCAAAAAGTATGGGTCTCATTCCACTGATGAGGAGCATGGAAAAGATTTAGGCCCAAAAGCCAGTTCACATGTCCAGCACTCCC
TCAAGAATAGTGGCAACTCGATCATGAACAATGACAAGTCCATGGCAAAGGCGTGTGGCGGAGTGCTACTACCTCGAAACCCGAACGCTATTCGGTTCGC
ACAGATAAGGCGGCAGTTTGAGGGCAAAAACGGAAAGCTACGCGGACCAAAGCTTCACATTCTAAAGGCGCAGATGTACGCACCCTCCACTTCCAGCAAC
TCGGAGGTCTCCGTTGATGAAAGTCGATGTTGAAGTTTCTGTTTAACTTAACGAAATTTACACTAAGGAGCGGATATGTTAAAATTCCAAGCACCAGGTG
GTACAATTCACATTCAACTGTTCATTCAGCAACAAGACCTGAAGAAGAATGAGTAACTCGGAGTGCGTCGTGACGGCCTTTGGCTGCAATGATGACGGGC
AGCTGGGCACGGGCGCTAAGCGTCGACCGACTTTAGCCATTGACGACGTGTCGGCCTCAAATTTCCCGCAACAGATCGGTAACCTACCTGACGAGGACAT
TGTGGCGGTCTCGTGCGGATCTCGTCACACTATGGCACTTACCTCCAGCGGCGCTGTGTACTCTTGGGGCTGGGGATCGGTGCGTTCTGACCACTTACGG
CGAATGATAGTTCATGTACTCATGCTTCGTTAATGGTAGATGGGACAACTGGGCCACGGAGATCTCAAGATCATCAATGAGCCGCAGAAGATTGCCTTCT
TCGAGCAGGAAAGGCTCGAGGTAGACTACATTTCGTGTGGAGGTTGCCACTCTGCCGCTGTGACCAAAGACGGAACGCTTTACGTGTGGGGTGAGTCGCA
CTGGGGTCAACTTGGCTTGCCCAAGGAGTATGAAGCAGCGCACGAGTCGTTGCCGGTTAAATGCCCCATGCCCGAGGGTGAAGCTGGCGAAACTATCGTG
AAGGTCAGCTGCGGCGGCACTCACACGGCTGCATTGACTAGTTTTGGACGCGTCTACGTGTGGGGACGTGGCGATAGTGGCCAGCTGGGCATCGGCTCTG
TGTGGATGAAGGACCCAGAGAACGAGAGTTTAATGGGAGCGAGCCGTCCGCATCTGCTGAAGGCATTCAATGGTGAGAAGGTCGTGCAAGTTGCTTGTGG
TGCTTTCCACTCGGCAGCAGTGACGGAGCAAGGACATGTGTATGTTTGGGGAAAAGAAGACTACGGTATGCTTGGCGTTGGCCAGTCATCCGACCAGCAG
ATCCCGAAGCGCTTAGAGTATTTTGACGACATCCCAGTACTGTACGTTTGCTGGCTCATGCGTGCTACTTGTATTTTATTGCTTACTACAACGAATACTT
GCAGGCGTGTATCATGCGGTGGCTGGCACACGGTGGTGGTCGCCAAGTCGGGAGACTGCTACGCTTTCGGACGGGGTGAATATGGTCGACTGGGCCTAGG
TGACACAAAGAGCCGTACCCGGCCGCACTTGGTACAGCTTGAAGCACTTCTGCAATACATCTTCAATCAACTAACAGCTCCCTGGCGCTCTTATCTCCTC
AGGTGAAAGCATTGAAGGGGAAAACGGTGATTCAGGCAGCGTGCGGTGGCTCTCACACTCTGTTTGTCACGAGCGACGGCACCGCCTACGTTGCAGGACG
GCCTGAGTGCGTACATGTTTTGACGAGAAGGTAGAAACCGCATCTGTATTAACTTTTTTTCTTTTTGCTGCAGCCATGGACGACTGGGTTTGGCGGACAT
GAAGGCCTTGGGAGTACCTACGCGTCTGGACTTAGGTCCGATCCCTGTTCGTCAGTTCTCTGCAGGCGGCGCGCACTCGGTGGCTTTGATGCACAGCTCG
CGCCCTATCTTCTCGCCTATGATATCTCCGATCTCCACCAGCGAGTCTGTCCCGCATGGTGAGCTATAAATGAGCTGTCATTCGGATGGCTATGCTGCGA
CCAGCAAAGGAGCACCGCTCGCAGCATTAGAAAGGAGCGACCTCAGGCACAACATGTACATGTAGACAAGTCAACGCTTTGAACAATGTACATCAAGTTA
CAGTGTTTAAGCTCGATAGACATCCATATTGGTTTCACAAGGCCTTTAATTTTAGGAGAATAAACAGGGCGATTTTCACTAAGAAAGGTTCCTCAGAGGA
ACAGGCCCTCTCAGAGGAACTTCCTCTTAATAAATGCGTTTGCAAAGGTGCTTTGTTGCAGATACCCTTTCGAAATTCGACTCGACAGCAATGAGCGAGG
ACGCGTCTTCGTCTTCTAGCGCCCACTCGCGCGACCATATTGACAGCCTGGCATGGTCCTCGATGCAGTCAGTCGGACGAGGACCTAGGCGCAGTGTGGT
ACGCACTACTGAGAAGTCGGTTGTGTTTCGAGTACGCACACAAGAAAAGCTGGCCGGTCGAGGGGATAAAAGCTTAAATCAGACGCTGTGCCTAACCCAG
AGCGAAGGTCGGGGCGGTATCGATGACAAGGACATCCATGAGACTCTGTCGGAGCTGTACGCAGATGCGGAACGGAAGAAAAAGTTGCTGAACAGTGAGG
AGGAGACGTTCCTACGGGGACAGGAACGTCTGAGTAGCCTTCAACGAGAACACGGAGAGCTTCTACACAGTTTGGAGCAGTGCAAACGGCGAAGGAAAGA
GAGGATTCGTATCCAGAATATGCTGCATGGTCCTGAAGCGGACAATGAAGACTACGAGCGCGAGAGGAGCATTGCAAGCGATAGTGGTAGTGACAGTGAC
CGCTATCGACGGAGTAGCAGCGGCAGTAGCAGTCGCCATCATCGGCCACGACGAGATGGAGCTAAAAAGGAGCGCAAGCGTCTGCGACGATTCCAGAGCG
ACGTGTCCCTGCGATTCCAGCTGCTCCAGTCCGAGTGTCGACGCTCTGACGTGGAGGTGGACAAGCTTAAAGCCGACTTACGGCGTGAGTACGCTGATGC
GTGCCTGTTTGGCAACTCGTTGAACTTTTAGCAAAGCTGCCGGTGCCGTGCAATACCATTTTCCACTTCAATATTATTAATAGCGATAAAATCTTCACAT
TGCAAAACATTTTTATTAAAAGTTTAAACACCCGTTTCGTGACGTTTCCCGCCGAAAAGTTGCTCATATTATTCCGTACTTCAATTCAAAAGGCCGTTCG
ACAATTAATGTGGGCTTCCGAGGCCGGGCTCCACGACGATGACCCGCGCGAGATCCAGCGTCGACGAGAGGCTTATGCTCGAGAGCTTGACCATCAAATC
GCGTTGCGCCGGGCACGTCAGCATCAAGAGGAGATGGAGCGCGAGGAGCTGGAGCGCAAGCTGGCGCCAACTGAGCTCTCGCCATCGAAGTGGCTAGTCG
AAGGCGGCCACCTGGACCCACCGCCAACCACTCAATCACCCTGGAAGTTTACTCAAAGTGTAAATCTCCATAACGAGCAGCAACAGGACCGCGGCGCCGC
CACTGGCGAGGCGAACAGCGTGTCATCGTCCCACCCGCGCTTCCGAGTGACTGATGAGAGCGAGACCAGCCAGAGGCTGCGGGAGCGCGCGCAGCAGATG
CAGTGGAAGCGGGTCTTAGACGAACAAGTGCAAGAGAAGGCTCGGCTGAAAGAGCAAGATGAGGCCGAGCGCCGATGTAGTGAGGAGGACGCAGCCAGAG
AGGAGATGCGCTACGTTCGAGAGCAACAGCTACGGGCGCAGCGGCGACTCGGACACTTTTCACCGGCATTGAACACCGAGTACAGGACAGATACCAATCC
TCCGTATCATGCGCTGCCTTCGCCGCCAGAATTGACGACAAATAGACAAAGGGACGACTTCCAGCAGCCTGGCAACAAGACTGACTTTGCGTTCAACAAT
GACGGACGGGACGATAAAATGTCGACGTATTATCGAGACCATCAGTATGGAAACCCAGGAGCAGCGGAAGCGATGCTGCCTCCGCCTGCACCATCACGTA
TTCCAATGCCGCAAGATAATGGACGCAGTACGAGGGAGGAAAGTCGGGATACATTTAATCGGAGTACAGCAGGTGGCATTGCTGCAAGGCAGCAATACTT
CCAGGACAATGCTTCACAGGCCTCACGTCAGCAACTGGAGCAACAGAGTCGCATAATTGATGAATACCGCTCACTTCTGGCAGAAATCCGTCGCGAACGC
GAGGAGTTACGGCGGGAGCGAGACGAGATGCGACAAGAGAAGGAGGAGCTGCGCGTGCAAAGAGCACTGCTGCAATTGGAGAACGAAAAGATGGCCAGCC
TCGTGGATGCACAACGGGCGCTCAATGAACAGCATCAACAGGACTTACAGGCACAGCAGGCACACCAAGAAGCTCAACAACATGCCCAACCTCAGCAGTA
TCAACCTGTTTCATTTCAGCAGCGACTATCACCCGTTCCATCTGCTGGATATGAAATGAACCACGGACGTATTAATAGCGGCTTTGAGCTACCTCATCAC
CAGGACGACCCGGAAGCGCTGGTCCATTCGCGGCTGAATCAGATACGCCAGACCCTCGGTGATTTAGAAATTCACGATGACCACCCCGAGCCTGTAATGC
CAGGAAGACGGAGGAAGCCACCGAGTCCGATGTCTATGGCGGATTTTTCAGCACCTACACCCCAGAAACGCATGACCGTCAGCGTTATGGACTCGCCGCG
CTTCCAGCGGTTGTCTCGGTATCGACCGACCCCAGCTGTTCCGGCTCACGACGAAAGCGCGCTGGATCAGTCTCTGATTGGCGAAAGCGTCTTTGTACCA
GTGAGTCCCAAGTCCCAACAGCAAAGCAACACCGGACCAATACCACGCACTACTTCGTCCCCCACTTCAGCTGACAGACAGAAAGAAAATCTCCGTACGA
ATGCTCTTCGAAGCAGCCGCGTCATCAAAAGTCGAGGTTTCTACAACTTCGAGCAGGAGCTCAAGAGTGAAGACAGACTGGAGTCTTTTGCAAGTGGATC
CATTAGTGGAAGTGTCCTCGACTCAGACCTTGGCAGCAGCTTTTATGGCGATGACGACGTAGACGATGAGATCGACAATCCTGACGACCAGAGCGCAGAC
CCTCATCCCGCAGCGAACAGTGGTTTATTCCAGGTTCAAGTGCTGGTGTGAGCTAGTATCAATATGTATTCAACGAGTAGCCTGGCTAAACGTTACATCA
AAGAACTCTGGCAACTACTGGTAGTTTTTTAGCGCACGTCACATATTATTTATCCATGTGGACCACATGAGCTGGTGACTGGCGCAATTGTGCCCATTTT
GTTGTTGCCTCCACGATGGCGTTCCAGTTCCCCGTGGCGAGCGGCAAGAAGAAGAAAGTGCAGGTGTTTGAGTGCCCTACCGAGACGTGGAAGGAGCGCA
AGCCTCGCTTCGCCAAGGTTGGCGATGAATAATTTGCTGTTTTGTACCGCTTATGCTGATTCTGACGATTGACACAATTGCAGAACAAAGCAAAAACCGA
TGAACCGGAGATGACGCTGCGTCAAGAAATCCGCAAGGAGTTTGACGATACATTCGACTCGGTCCTGGATTTTGGTGCGCTACAACTCTGATTTTACTTA
TAATTTTCGTTGCTGTTGAGGAGAATAGGATATTGAAGAATGGACTTGTTCGGTGGCTTGTTGTTGATGATAACAGCAACGTCGAACTTAAAGGGCAAGG
AGAAGAAAATGCACGAAGCCAAAAAAATTGAGTCACTGGGTGGTATGGCAACCAAGAACCGCAGTATGCCGTACAAAGTGCTGATTGGGCTGAGGACCAA
GGGTGCGGCCAAAAAGCAGCGTCGCGAGGAGCTGGTACGTTTATGTTTTGCGCTTTCATGCGTGAAAGTTGCACTGGAGCAGTCTTCTAACGCATCTGTT
TGGTGGGCTGTTGTTGTTAAATTTAGCTGAAGGAGTCAGATGTGGTGACGGGCAAGCGGAAATTGAGCAGCAAGTCGAGGGACCAGCAAAAGCGCAAGAA
GGTCGACTACGGTGTGCAGGCCACCAAGGGACGATTTAAGGGTGGCGTGCTGGACGTGCGGGGTCTGTAATATATTATACACGCAGTCGCCTGGCCGACA
TTCT