Description :
From Genome Similarity Track
Location :
Scaffold_28:133058- 135681
Transcript NameFunction/comments
Hyaar_Emoy2804353hypothetical protein

Sequence
2623 bases(100 bases per row)
GATGAAGACTCTCTGTTGAGATGGTTCGTGGAAGTAGACGGTGCCATAAGGGCTCGCCATATCGTCGATGAGAAAATGCGGATCGCATTTGCTCAATAAA
ACTTGGCTGGGCGTGCAAAGACGTGGGCCTTGGATCTTAAGTTACACGACCCATATTTCTTTGGTTCCTTGGAAGTCTTTAGGTCCCTGCTTAGGCAAAC
ATTTGAGCTGCCGCGAGCTGAGTTCAGGGCTCGCTCTGAACTCCTGAAAATCAAGCAAGGTAAAACGTGACGTACACTCGTACATTCAGTACATACGTCA
CCTTACCAGTTGCATAACAGTCGACCCACTGAACCAACAAACGTTGATTACGTTGTTCATGCAGGGTCTGACTGATGGTCCTGTTAAAACCTAACTGTTC
CGGTTGGAGTTCAACACCCTGGGAGAGGCGATAAAAGGTTGCGGAACAGGAGGACTTAAGCGTGAAACAGGCTCAAGCGAATTCAAATTCCTATCGTCCA
TCGAGACGACAGGAAAATGGAGGCCCAGAACCAATGGACCTCTGTCACGCGGGGAGTGAAACCTCTCGTGTTAACAACTACAAGAAATTGCAGAAATGCA
ATAGATGTCAGACGACAGGGCATTATGCATACTAATGCAGTGCACCGAACGCGGTACCACGTACCGCAAGAAACAGTAACCGCCAAGCGGCCAAGCGGGG
TCCAAGGCGTGGGTCCGTCGTTGTAGCAAAAACGCAACGTAAGGGACAGCCAGAAAACGGTCAGGGTCAGTAGGTGCGGAGCACCCTACTGATCCAGCAA
CGTCAAGTGAGTTTGCGGGCCTCTTGACGAAAGTCGCTCCCAACACGCAATCATTGTGTGTTACTGCATCTGGTTATGAGGTTTCTCTCATTGCCTTGAA
ACTCGAAGTGGCAAAGGAAATTACTACGAGCCATAGTCGATTGTGGGGCGTCAAACAACTTTGTACAATGCCCATCGCTAGACAATAACAAGCTCAAATA
TATCGAGCAAACGATACCTCCAACGAGGATGACGGTGCGCCTCGCAACAAGCGCATCCGTAACAGTGATGAAACGTGTAGTAGGAATTTCCTATACACTG
AAGGGAGTCCAATATAATGATGACTTCATCATAATAGACTTGGTTGACAAATTTGATATTATTCTTGGACCGCCGTGGCTCAGAAGGTACGAGCCACAAG
TCAGCTGGCATCGACGAACAATCGATATGCCTGTCACTTGTTCATCATATGGTCATCGGATGAGCTCCTTGGAGCGCCCACTAACGTGTGGGCGTACTAC
GAGCGAGTGCGATGGCCTCGCGTGTGGTTCGGTCGTTAGTACGACTGCGCATGGCCATGGCGTGGCTGATCGCCACACCATGAAGTCAGATTCCGGAGAC
TGCATTGAGATGCGTACCGAAGGCCCACCACCCGAATAAGTCGAGTGGACTGGGGCATGGGTGTCCTCCAAACGGTCAACACCCAAGTGAAAACGAACCG
ATTGCCAATGATTGTCAATACGATGATCTTAGTGCGATTGGAGAATCGCACGTAGAAGACCTGGCCGCGGTAGCGCAACCACCGCGAGAGGATAACGAGA
GAGCAATTCCACTCGTGCCATATGATGATTTAGCCCAAGAGTCTGGTGAGGGAATAAGTCTCCACCCCACTGTGGAAATAAGTTCCCAGGAGACAACAGA
GACATTAAATTTTCTAGTCAATGACGGATAAAGTATAGGGACATACCAACTTGATCTGATCGCGCCTCCGAGGACAACTTCGGAGATCATTCAATTGCCC
ACGCTCGAACAGAAGAGGTTCTTGCGTGATCTGCGTAGTGGCAAAGTCAAGCAGATTTGCGTACTCATCGCGGAAGACGAGTACGTAACCGATATTCGGT
CGGCAATGGTGTTCGCTGAGAATGAAAGGGTTCTCAGCAGCTCATCAATGGACGAGAGTGTCTTTGATGAGACGACTCGGATTGAGCGATATACATCCCA
ATCGTGGGAATCGCTCAAGTCAAATCCTCTCTAAGACGATTTGACGGAATTCAGAGATGCGTTCCCAGAAACATTGCCGTGCGAGCTACCCAAGGATAAG
GGTACTCGTCACGAGATCGACCTGAAACCAGGTTCAAAGTACTGTGTCATGAAGGAATGACCACTGCATCGTGAACAAGTACCAGAGATCGACAAATTCT
TTGCCGATTGCTTGGCAGAGGGCCATGTGAGGGAATCTACTTCCCCACATAGCTCTCCGACCTTCTGTGTCCGAAATGCAACAGGAGGATGGCGAATAGT
ACACGCCTTCAACAAGTTGAATGCTACAACGGTACCAGCTCAAACGCCGATACCAAGAAAGGATGTCATTATAGATGGTATGGCAAGGAGTACCATCTTT
TCATTGATGGATCTGATGGACGGGTTCTATCAGATCCTTATGCATGAAAGGGACATCCCGTACACTGCGGTGAGCACCCCAAGTGGTATGATTTGGGAGT
GGCTAGTGATGACACAGGGGCTGAGTAACGCCCCTGCTACGTTCAACAGATGCGTTACGTATCTGTTGAGATCTGTGCGAGAATTCGCACCTAGCTATAT
CGATGACGTGTTCGTCCATAGCC