Description :
From Genome Similarity Track
Location :
contig_100:13302- 14709
Transcript NameFunction/comments
g12975.t1hypothetical protein

Sequence
1407 bases(100 bases per row)
GTTGATGTTGCCCATCCCAGGTCCCAATCCATCCATCCGCGCCCATCGCCCAATCACCTGGTCGGAAATGATCAATCCATCACCAACCCTCTGATCACTT
CTCCACGTACACTCTCGTATTGTACGACTTCTATCTTTCAAAACAATCCTGGATTCCTTTACAACACACTGCGGGGTCTGCTACATATATCAGGCCTTGA
ACTAGCATTACTTTCATTGACGTATAACTGGGCAGCAGCTCCGGTGACTTCACCATTTGCGTACATCAGACCATTTTCGCAGCGATAACATTGTTTCCAG
GTGTTCACCAATTAGTGCAGCAATGAATACCCGATGATTATCACGGCTGTTGGCTTGTGTCGAGTCGTCAGTCAAGTCAGCAATGGGTTCTCCACTAGCT
AGGTTATGGCAAATGTAGGCGTTGTTTCTTGTAATGTCTATCCTTGCCATTGCTAACTTTTTGTGCCATTTTTTGAATAAATTCCCGCCCGCGATAAATA
ATCGACTTCGAGTTGATCATGACGATCAACCCTCTGCATGGCAATGTTATATTTGCGCATGCAGACCGGAGCCTAAAATCCCACTCGTTTTTGCGCGATT
CTACGTAATACCGCTATAGTACCCGATTCGTCGGCATTAGACACAACGTTTACGATGGACCCGTCCACTTAACTTGCAGCAACGATATGTTTCTCTACCC
AAATGCCTTGATTCATACCCCCTCGCTCTTTGTCTAATTTCGGGTCTAGCATAGTGAAGTGAGGGAAATGGTTACTGGCTGATCTAACTGTGCTGCGGTC
ATGCAAACCCACAGATCGTAAGCTCTCAATGAGGAGACAATATTTATAAAAAAATGTCCGTATTGACAAATCGACGTGACTCTTGCAGCGTGTTTGTCAC
TTCCAGCACATGACGTCGGATATCAGACGACTTCTTCGTGATATCGGCAAGACGGTCAATCTGGGAGGTCTCAATCATACCTCCCAATATATCGTGACGT
TCACTAGCGCAATGAAGCTTAAAATTCACTACGAGCCAGGTAGTGGAGCAACAGCACATACAGCGTTTGAAGTGGTATTATCCGGGTTATAAATGATATG
TCTCGCGTACTTTGAGCGGGATACGATACTGACCTCATCGACTGCTACATTCCGACCCACAACAACATTGCGCGTTCAGCGTGATTTTAGCATGGTACGC
AGCGGGCGGATCCTTGCAGCAGGACCACGCTGAACTTCAGCAATCGTCACTTCCGAGCGAAATGCCAAATTCTTTCGAATATACAAGAATCGATGCCACG
CCATGATTGAGTCCAAGTTAGCGAATAAAGCACCAGGAAATATTCTTGCTTCCTCATTGTCTCCCCAGTAGTTTATCATTTCGCCTGTGCCCACTAGAGC
CATGTGC