Description :
From Genome Similarity Track
Location :
Scaffold_793:13300- 14934
Transcript NameFunction/comments
g4891.t1hypothetical protein

Sequence
1634 bases(100 bases per row)
TCCATTTCTTGGATCCCGTCGGCTTCAGTCTGATGCAGACAAGAATACTGGAGCAGGAGGCTATCGGTCGTGTGCTGGGCATGGGTCAGACGAACGAGCT
CGTGACGGTTGGCCGGCTCATTGCTGAGGACACAGTGGAGGAGACGCTGCACGATGACATCCACGAAGCAACAATGAAGATCATTGCAGCGGACAATTTC
TTCTTCGACGGAGAGCGTGGAGACGCGTACTTGTGCTCGGCTCCATTTCGACGAGTGGTGCACATGACCGGAACTCACGAAGTATCCAGCTCGAGGGTAC
TATCGCGCACCGAATAGAGCAGGCAGCCGCAGAAGGCGAGGTGTTCGACCTCACAGAGGACGCGGCGACGAGTCTGGAGCAGCAACTGCTCGTCATCCGA
GAGCACGAACGCCATTCATCAGCGCGAGATTCGCACTCGCGACAGTACAGGCAACAACCTCCGCAGCCGCAGCTCGAGGAGCAGCAAGTGAATTGCAGCG
AGAACGACTACAGCCAGGAGCATACCTACAACATCTCTAAGCTGTGCAACGTGGTGCTCCCAATCGAACTCTCTCGGCTCTTCAAGTCGAACGGTTGTCA
ACAACGTCATCGCCGATGGCCCAGTCGAAGATGCCGCTTCTGCTCCGTAAATGCCGGATATCTGCCAAACTGGAGGCATTTGGGCGGGAGAAGTGATCAA
GTGCGCGCACAGTGCATTCAAACAAAACCTGTGGAAGTAGATACCGTATCTTCACGCGCTGGACATGGTGCACCCGAACGAGTAGAGCTACTCGAACCGG
CTGCTCAGTTTTCGACGTTGAAGGACAAACGTGCAAGACGCTCACTGATGGCCCACAATTTGGCGGCGGCTTCCTTCGACTTGCTGAGCTGGGGAGGATC
TCCACGCACTGGATTGCCGAAGGACTTGAAGTATTGGGCTCCAAAGTAGGCGCCACTCTCGACTTCGCGGTATGTAGCTGCGTACAATGTCGAGAGCGCC
CGCTCGAGCATTTTGCTGGGACAGAAACTTCCCGAGGTTGAAGAACAGCTCCCAGAACCAGTTGCTGTTGGAAGACGCCGGCATCGCCTCCAGGTTGGTA
GCTGCTGCCCCGGGGTTGCAAGCCACGGAACGCAAACGGCATCTGCAACTGGATCATGACGAACGACGTGTTCTACCGCGAGGCGCTGTCACAATTGAAG
CGCGACTACTCAAAGCTGGAGCAGCACGCGACTGAGCTGAAGCAGGACAACGTGGAGCTTCGCAACGCGCTGCTGGCCAAGGAGCAGCGGACGGCCGAGC
TGCAGCGCAAGAACGAGACGCAGGTCAAGGGCGCGGGCATGTACCAGGCGCTGACCTGCGAGGTTGAGGCGGTCCAGGACCACCTATAGGAGACACAGGA
CGACTGGGCCAGGTGCAACCAGGCGTGGTGTGACGGCTGGGACAGACTCACCAACAAGCTCGCAGAGGCCAAGGCCGAGGCGACGAAGTGCCACAAGAAG
AGCAAGACGCGCCACAGGAAAATCAAGGCGCTGAAGAACAGGGCGGAGACGACTATGGCCACCAGCAATATCTTCGCGCTGAGGCTGCTGGCCGTGGTGC
AGGAGAAGCAAGACGTAAAGACGCAGCTGGCCCG