Description :
From Genome Similarity Track
Location :
Scaffold_639:1330- 3554
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_639-fgenesh-gene-0.0Phosphatidylinositide phosphatase SAC1

Sequence
2224 bases(100 bases per row)
GGCGACGATGTTCAAGGTCCACGTGGAGAATACGGAGCTGCTGCTGGAGGACTGCCGCGCCGGCGCCAACGGCTGGCTGCGCGTCTCCGTGGGCGTCGAC
CCGCACGGCATCTCCGGACTGCGCGGCGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGGGCTCCTCGTCCGGAGGAGG
CCCCGCTGGACTGAGCGCCGTCGACATTGAGCCCATCGCGCACGTCGCCGACGATCGTCAGGACCCGCACTTCATCTCGATCCACGCCGTGTACGGCGTC
TACTCGCTGCTCAGCGGACCGTACCTCGCGGTGATCACGGACGCGCGCGTGATCGGCTCCGGGCCGAGCTCGGAGAAGATCTACTGCGTGCTCGGCGCCA
CGCTCGTGCCCGTGAGCGCCGCGGCGCAGCGCAGCTTCCACAAGCACGCGTCCAAGCGCGAGCAGAAGGACGAGCTCGAGTACATTCGCATGATCCAGTC
GGTGCTGGCGTCGCGTACGTTTTACTTTTCCTACGATTACGACCTCACGCTGTCGGCGCAGCGCCGTGCCGGCCACGCGACTGCGAGTGCCGCGGCGCAA
AAACTGCCGCTCTGGCAAAAGGCCGAAGACGATTTCTTCTGGAACAAACCGGTGCTGACCAAGTTCATGGACCTCGAACTCCACAACTGGATCGTGCCCG
TGATTTCCGGCTTTGTCAAGGTGCTTAAGAAGATCGAAGTGGACGGCCAGCGCTGCGATCTGCTCTTCTTCACGCGGCGTAGCTGGCACCGCGTAGGCAC
GCGGTTCAACGTGCGCGGCGTGGATAAGGACGGCTGCGTCGCCAACTTTGCCGAGACCGAGATGCTGCTGGTCAAGCCCGACCGGTCCATTTGTTCGTAC
GTGCAGATTCGCGGGTCCATTCCGCTCTACTGGGACCAGGTCGTCACGCTCAAGTACATGCCACGCACGCGGTACGCCTTTAGCGGCAACGAGAGTATTG
TCGACTGGAATGAGCTCGCGTTCCGCGCGCACATGGACAATATCATCCAGCGGTATGGCCACATCACGGTCGTCAATCTCATTGACAAGAGCGGCTCGTC
CAAGACGGTGCGCGACCAGGCTCAGCTCGGCTCGGCTTACGGCAAGTATGTGAAGAAGTACAACCAGCAGAGTCTGCAGGCTGCCAGCGAGTACCCCGTC
GCGACGACGTCGGCTTCGAACGGCTACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTCCGTCGACGC
CAGCGCAAGGGTCGCCGTCGTCGGTCGCGGCCGGAGGCTCCTCCAAGTCACTTAAGGTGTCGTCGCTATTTGCCGAGCCCATCGTCTACGTGTGGTTTGA
TTTCCACCACGAGTGCCGCAAGATGCAGTGGGGCAATCTCAGCAAACTCATGGCGGACGTCCAGGACCAGTTTGCACAGTANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAAAAGGGCGTCTTCCGCGTCAACTGCATGGATAATCTCGACCGCA
CGAACGTCGTCATGTCGCTCTTTGCGCGTCGGGCGTCACTCATGGCGCTGGGTCTCTACAATGAAAAGACCGTGACCAATGTGCTCGACTCGCCGTTTGC
GTCCTTTGAGATCGTCTTCAAGCACACGTGGGCCGACAATGCCGACTACGTGAGTCGCATGTACGCTGGCACGGGCGCGCTCAAGACCGACTTCACGCGC
ACGGGCAAGCGCACGCTCGCCGGCGCGATCCAGGACGGCATCAATTCGGTCACGCGGTACTACCTTAACAATTTCGCTGACGGCGTGCGCCAAGACGCGT
ACGATCTCGTGGTCGGCAATTACGCGCCCGACCGTCGCGACGAATCGCCCTTCTCGTTCCAGCACCAGCACACGCTGCTCAACATGGTGCTTGAAATGTG
CATCGCGAGCGCGCTCATCATTGGCGCGAGCGTGAGCTGGCGTCCCCACGAAGACGTGTCGACGAGGCTCCGCAACGGTGTGGTCGCGTCGGTCGCCGTT
TTCATGGTGCTTGGGTATCTTATGCTCAAGAAAGGCTCGTTCCGCTCGCTTGGGAGGCGCTACGTGTCGAAACCGGCCTTCTCGTCGAGTGGCTACATTC
GCAAAAAGGAACTGTAATCGATGC