Description :
From Genome Similarity Track
Location :
Scaffold_250:1330- 2433
Transcript NameFunction/comments
Phyci_98791Hypothetical protein

Sequence
1103 bases(100 bases per row)
CCGGAACTCGCATCTGCGGTGAAATACTGGGTTATCATTGCAGCGGGCAACGGTGACCTTCAATCGCTTCAGTGGGTCTGCAGTCTTTCCACGATTGCCA
ACCCTTGGCATGGTCTTGACAAGGCAATACAGCAGTGTCATTTCGATGTGGTAAAGTGGATCTTGGCGACGGAACCAATTGGTTTGACCACCGGTAAGCC
TCTTGCGATCAATCTGGACGGACCAGTGGCCAATGGACGTCTTGACATGATCGATTGGTTGCTGCGCTATGATCGAGATGCGTGTTTCGTGAACGGAAGT
GACCTCGAAGCTGCGCGAAAGGGCCATTTCGAGACCGTGCGTCTGCTCCGAACAAACAAGGTCAAGGGTTACTCCGAGCGTGTTCTTAGAGCTGCGGCTG
AAGGAGGTCATCTCAACCTTGTGAGGTGGCTGTGCGAGCACGAAACTCCAATTCTGGCTGGTTTCGCGGACAATGCCACCGACATTGCGGCTACAAACGG
GTTCCTGGATGTCGTCAAATGGCTACATGAAAATACAACCCAGAGGGCCACCACATTTGCGATGATTGGAGCCGCTGCAAATGGCCACCTTGAAGTCGTT
CGGTGGCTCCACCAGAATGCAGCAGAGTCTTGCTCGGCCGACGCTATGGATCATGCTGCCCGGTCCGGACATCTTGAAGTCGTTATTTGGCTCCACGAGC
ATCGTGGCgaaggatgcacgcccagagcgatggacggagcagccagcaatggccacctcgatgtcgtaaagtggctacatacgaatcggaccgaggggtg
cacgactaaggcgatagacaacgctgctgctaatggacacctagctatcgtgaagtggctgcatttccacagaagtgaaggctgcacCACTGATGCAATG
GATTTCGCCGCCGTGAACAACCACTTAAACATCCTGCGCTGGTTACACGAATACAGGGTGGAGGGGTGCACTGCCGCAGCCATGAGAACCACTGCAAACG
CAGGTCATGTGGAGACATTTCAATGGTTACTGGCACATCGGTATGTAGGCGATACAGCCGACGCATTGGAACGTGCTGTTCGAAATGGCCATTTCGACAT
CGT