Description :
From Genome Similarity Track
Location :
Scaffold_2082:133- 3940
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2082-snap-gene-0.2Chromodomain protein
Pytar_ATCC12531maker-par_contig_2082-fgenesh-gene-0.1Inositol-3,4-bisphosphate 4-phosphatase

Sequence
3807 bases(100 bases per row)
AAGCTTGGTCGTCCACGTCTGGGACTTGCGATGAACTACAACTGCTAGTGTACAGTCACCCAATGGAGGATGGCATAGTTCGAGTGAGGTGAGTTGTGAC
GTGGGTACACTCCTAGGCACGCTCTTAGTCATCCTCGGGCGTCGTAGCAGTAAGCACAGGCGCCAGTGCGATTGCGAGCTGCACAAGAGGAAGAAAGACG
TTGCAGGTAAGTCAAGGTCCAAGTCATACTAACCGTTGCAGAGAAACGGGTGACGTACCGCCGAGGCCGACATGAGACTAACGCGCGAAGACAACCCAAC
GTTCTGGGTCTGCACGATCCAGCTACGAGACGAACGACGCGTCAAACGGCTGTCTGATGGAAAAGACCACACGCGAAAGCGTACCTGTCCGACAGGGCGA
GCGCGAGTGCGCCAACGACAAAGACCCCAAGTGTCGTCTTGGACCCCAAATCATCACTGCGTGCGATCGAAATGAGCGCGACCACCAGCGCCGTGTACGA
CACGGTCGCCGCGCCGATGGCGACCTGCTGAAACTCCTGCATCCAGTCACCAAGAAGAACGAGAGATGAGACCAAACCGACAGACAGCAGTGATGAGTCA
GAGACGTACGAAGAAGATCGAGAGCTCGGCGGCGATGCGCCACGACAGCGCAATAGCGACCCACTTGGCGAGCGAACGCTCGTCGCGCTGGTGGAACACG
AGCAGCAGTGCGACTGTCGGCGTGAGAAACGGCAGCCAGAGACGCCACTGGCTAGCCACGACGACGTCGTGGCCGCCGGGCACAACACCAGTATCCTGGT
CATCGGCGTTTGGCAGCAATTGGCTCGCGAGCAGCGACGCCGCGACCACCACGACGCTGAGGAACCAGAGCAGCCAGTNNNNNNNNNNNNNNNNNNNNCT
GCCACAGATCTTGCAAGCCGGCGGCGTCGGCAGCGTCCTCGTGTTTGGTCGTCACCTTGCTAGGCGACGCTGGGGCCTTGTCTACTTGTTCCTGAGATGA
GACGCTCGCCACCTCCTCGTACGCGAGCTGCACAGTGGTCGCTTTTTTCTCCCCGTTGAGGGGCGAAGGCGAAGGGTGATCTTGGCGGGGTGGCGCCGCC
TGGTCCAGCGCCGCCAGAGTCTTGCGCAGCAGCTCATCGCCGTCGGCGGCGCCGTTTTTCGTCTCCTCGCCTTCCTCTGCTTTCTCCGACTTGCGCGGCG
CCCGACGGCGCGACGCCGACGACGACTCCGAGTCTGTACCCGTGCCGTTGGCCGAGTCTTTGCTCTTGCTCGACGAGCGACGGCGCGAAGCAGATGGCGA
GCGGCCCGTTGAGTTGCTGCGTGGACGGCCACGCGGGCGACCGGGGCTCTTGGACGAGCTCTTCGCAGTCGTGCTGCTGCTCTTGGCGCTCTTCGGCGCT
CGGCCAGGGCTACGGCCGCGGCTCGGACTGCGCGACGACGACGTGCCGTCCGTGGACGACTCGTGGTCGGCGCTCTTGCGGCTGCTTTCGTACGCGCGAA
TCACGTCCGAGTACCCATCGGCCACGAGATCGAGGCGGCTTTCCCTGTCATGAATTACCAGTCAAGCGAGTCTGTTAGGCTCCCTGTGAACGGCGCGGCA
GTTGAGATTGAGCAGAGACGCACCACGTGTTGCTCTCCTCGCCAAAGCCTTTCCAGACCACGAGGTACTGCACGCGGTTGCGGACAGTCTTGCGGTCGAT
GATGCGGTCAATCTCCGCGCCCATGGTGTTCTTCTCTCTCTCGGTCGCTCGTTTTCTCTCTCTTTCTCGCGAATGGCGTCTGGGGGTTGGCGCGCGCGGT
TTGTGAGACTTGTGGATAGGGAGGATGGACGGGAAACGAGAGGGGCTGGTCCAAGTTTCAAATTTCGGGATAGAGGCTTCACCACCAAAAAAAGGTGAGC
TATAAATAGCTCGTACCAAAACAAGGTGATATAGTCACCAGTTGGGTTTGTATAAACTAATGTAGCCATCTATTTTCGTTCTTTTGGTCAATTTCCGTCT
AGCTCACGTTGCCGCGGCCGTAAGTGCCTTCGGGGCACTTGTACTCTTCCGGCAGCAGCGAGCGTTGCAGAGCGTTGAATGCGTAGTGGCGCTTGCCCGT
GTTCTTGAAGGCATTCTCAAGTCGTACGCCATTGCTTCGCATGGTCGAGACAGTGCGGGCGAGGTATTCTTGCGGCAGCCCGTGGTTGTCGCACAGCAGG
TTGCCCTGCTCGAGCGTGACCGACATGCCCGTGCGGTCCTTTGCGCTCTTGCACGACGTCACACGGCCAGCGAGCAGCATTCGGCAGAGCTTAGAACTCA
GCTGAATGATCTTGGGGTGCTTGGTCTTGACCATCTGCTTGCTGGCGGCCATGATTTTCTCTTCGAGCTCACACAGCAGATTCTCCACGGCCTTGAGATC
GGTCGTGTACGTCCCCGGCTGGAAGAAAGAGAATTGTCAGAACACCACATCTACCACAGAATGTACTCCGAGAAATCGACTTACCACTTGACACGCGAGG
CTCTTGTACTTGTCGACGTATTCCTTGAGCAGCAGGAAGTTGTCGTGGTTGATCGTCTGCTGCAGCGTCGTCTTCTTGGTATTGGATCCGTTCGCCAGCG
TCTGCATCTCGTTAATGCCCTGCGTGAACATGACAGCCGTCACGGGGATCTTGGCGCCTCCGCGGATGCCCGCAGGAATGTACTCGAGCGTGTCCTTGCT
GCAGCGCACGCCAATCACGACCGTGTAGTTGCCGCTCTTTGAATCGCCATTGAGCCGCACCGACACGACGCTGGGCAAGTCGAGGTCCTTAATGTGCAAG
TTGAGCGTCGGCGGCAAGTGCGCCGCGGGTGCCGTGTCCAGCACAAACTGCACGCCCTTCATGGCCTCGATCGCCGAGTAAAAGTCTTCGAGCATGCCCA
GCTCCTTGCCGTGGGTCGACAGCAGGCTCTCGACTTGCCAGAGGAACCCAATCGAGTCGACGACGTGGAGAAACTGGTGGTTCGACGGGTGCTGCAGCGC
CGCTTCGAGGTTCCGACAGAAGGACGCGATCAAAGCCGTGAGCGCCTGCGACACGCACATGTCCATGCGCATGACAATGTGCCACTTAAGCTCGTCCTCG
GCGCGCACCTCGGCCTCGGTCCAGTCAAAGGCTTCTTCGACCGCCTTCTCTGAGAGCCCACTGCCAATGCGCGATAGTGCCAGCCGATCGCTCGCGGAGC
GTGCCGGGCCCTTCTTGACAATGCGATTGCGCAGCGAGATGATGCCGGCGCCGTGGCGGAACTTAAAGCCGTGCGCGGCAAACGCACCCACGGTCACGCC
CGTGTACAGCGTGACTTGCTCCGACGTGCGTCGCGAGAGTTGCGACCGCAGCTCGGCCGTGGGACCGACCCACATGTCCTGAATGTGCAGATTGATGGGC
AGGAACCGCAGCAGCAAGCTCTTCTTCTCCGTGCTCGCCTTGATGTTGATCCCTTCTTCGGCCCGGCTGACACAGAGCTGCTGGCACTCTTTGAGCGCTT
CAATGTACGCGACGCGCTGCCGCACGCGTTCTTCGAGCCATGACTGCGCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNGTTCTCGCCCTGGATCTGGTCAATCAGATTGTCGTAGAGACCCGTGGCGAGCCCGCGCTTGCACTTATCTTGGAACGCGCGCAGATCGACCTCGGC
GCGCGCGAGATCGCTCGCGCGGTCTTTCTGGAGCAGCTCCAAGAACTGGCGCGGAATCTCATTCGTGAAGATGCTCTCCGTCATGTCCTCGACAATCATG
TCGTCGC