Description :
From Genome Similarity Track
Location :
Scaffold_2673:133- 2293
Transcript NameFunction/comments
Phyag_g12694hypothetical protein

Sequence
2160 bases(100 bases per row)
AGGATCCATAACGAGCTCACTACGACTGAGATCCTAGATACTGCTGAGATCCCAGCAGTAATGTCGTCATTAATCACCATNTTTTCGGCCAATAGAATGC
GTCCTACATCAAAATTGGTTTTATTAGCGAATGAACGATCGCCGTCCACTATATTCCAACCAATCAGAGACGTATTGAGATTGTGAAGGACGCGTGTCCA
CACCTCCGACGTATCGCGTCGGAGGCTGTCTCCAAGATATTGATATCCTCTTACAGTTCCTCTGTCATTCGCATATTTTACGAATAACAATcaatctcca
gctcctccgtcCAGCTATGAGCCTTATCGACCTTGCACCTGCCAACACGAAGCGAGCCCGCGAAGGTGCGGCGAAAGCGTTCCTGAAATTCCTGAAAGAC
GAAGACGTCAGCTGGGACTACCTGGAGGTATGCATGCAGCGAGAAAGCGCTCCTCTCATTCTCGAAGCCGTGGTGGACAAGCTCGGCATGCACCTAGCCT
TTAAGGAAGGTCGCAAGGGACAACTCCTAGCCCGACACTCGGCGATGCAGCACTACCGACAGGCCAAGAACTGGCTGCTCGATCAGTTCCCCCAGCATCg
cgcagcggtggagaagaatctACTGAAGAAGAATCAAGTGCTGGAGCGACACTGCATGAAGCGCGAGTCAGGCACATTCGTCAACAAGGCGCCGGCCTGC
ACGAAGAAGGCACCTAAGCAGATGACCGAGTATCTGTATTCGACTGCTGTTACTGCCGCTGACTACCAGAATGCTGCTCTCCTGTGCTTGCTCTGGTATC
TGTTTGGGTGTGCTTCGGACCTGACGCTTCTTCGCAAGGCAAACCCGTCAATTGGCTCCGGTgacatcttcttcgttcgcTTCATCCGTGTCAAGACATC
GGAAGAACAAGGCTTGCCGCTCTTCCCGGACGATGATTTTGCCACCTGCCCTCTGCTCGCCATCGCTCTTGCGTTAATCATCCAGCAGTCTCCgacggtg
tcgctgctgagcCAACNCGCATTACCCGGTATCCACAGCTACGTGAATCGTGTCCTTGATCGAGTCGTCGCTAAATCAGGGGTTACTGAGAAGTTGACGT
CCCATTCGTTTCGCCGTGGAGAGGCTCAACACGCGAACACCTGTGATCAGCTGACGGCTCGTTGGATCTTCGATCGTGGCACCTGGAACATGACCACAAC
GAACAAAGGGTTCAGTTACATCTTCAACACTAGCTCCGAGGACCACAAGATCAGCAAGATACTCAGCGGCCACGATGCCGACGCCTCGGCGACTCTCCAA
ACGCTGAAGGCCTTCGACTCCCAGACGCGCACCAAGATCGACGCGGCTCAGCGTCTCCTCTTCTCGACCTGCCAAGACCTTGACGCTACAAGACATAATG
TGAATCAGCCGGTTCTCGACGTACTTACCGCTTGTGTGCTTCGACAGTATCCGCTGCTGAAGGAACTCAATCCCGACGCTCCAGTACTGAAGCGTGTCGA
AGCGTGTGTCGTCCACAGCGGTAGCTCGCTCGCagagcttcttggctggTCATCGCACTTGGTATCCGCAGCCTGGACCTGTGAGAACATCAATTACAAA
AGTGCAGACCGCACAACCTCGCAAGCTTTCAACCCAACCGAAGAATCTGAAGAGCAGAAGACGATTCGTCACCAAGCCGCTGTCATTAACCATTTAAACG
AGCAcgcccagcgccaacacgTACGCATGGACGCGCTCGAGGCAAAGCTAAACAACGCTCCACTAGAGTCTACAAACAAGCGTCAGAAACAAGATCACGC
AGACGACGAGGTTAGCAAGTCCaaaaagaagcagcgcggGTCCTCGGTCACTCACCTGCACGCGACATGGTTCGCGTTGTGTGCGCAAGAGCCACGGCTG
TGACAGGCGTCcatctccaagcagcagaagtccggcgccaagctgctggttgccTTCATGAAACTCTTTAGAACGACGGCTTCGAGCTGGACACGGCAGC
ACCGGACTATCGCGATGGGGTCCTCGACTTGGGCAAGCAGGCGGAGAAAGCGGTGCTCGCGTTCTTGGTCGAGTGGAAGGTCACGTCGCGCGGATCAGGT
ACCATCCTCAAGCACCTTCGCACTCTGCACCGCTCTGGTGACCTCAACACCATGatcaag