Description :
From Genome Similarity Track
Location :
Scaffold_677:133- 1645
Transcript NameFunction/comments
Phypl_g10256hypothetical protein PHYSODRAFT_324732

Sequence
1512 bases(100 bases per row)
CGTTGTCTTCCCAAGGCCAAACACATTGTCGCGAGCCGCCCTTGGGTGGACCGGTTCTCGAGGTGTATACAAGCAGAACGCTGGTAGAGAGTTAGAACAG
ACCAATATGATTGAAATATAAGTAAATCAACTTGTTGGATCCAAGGCTTTTTCACGACTGACCTCTTTCATCACGAAGGCGGGCTGCCCAGTCGCCCTCC
TTTCCTCTCTCTCGCTCACGGCACGGGCGCTCATAGTCCTGAACCCCCCTACTTCGCCCCGCCGTCTCCTGGTCCTAGCTCGAGCCACTCCGCTGTAGCT
CCACATGCATGCCTTCCGTCCTCATCGCTCCGTCGTAGCCCGCGCGCCTCCTGTTCcgagccttcttcttcaatgtCGGTAACTGGCGCGGCTGTTCCGG
CGATCTGAGTCTGCTCTGATTCCGAGCCAACGGCTTAACGAGGGGTTTGATCTGTGCCGCCCCGATCCGCTTGCGACAGGGCTTCGCGCTCATCCTCATA
AAGCTGCTCTGCCAGCAACTGATCAGCCAACGTCGCTTCACCGAGGGGACGGACTGGACCGTGCCCCAGACGGTTCCCACCGTTCCCACTCGGGACATCC
CCCCCCGACTGAGTCGAgacgtcctcgtcgagctgcctCCTCACGGACTTGGCGCAACTGGTCCCGCATCGCGCGGCGCCTAGCAGGGGTTCCAGCAAGG
GTGAACCGCGGCCTTGATGCATTGCCTCTGCCTTCCATACGCCAGTACGCTTCGCTCAGGCGCTCCTCTTGTTCCATGTCTTCCATCTCTTGCAGTCAGT
CTTCATAGCGTTCACTGATCACCTGCCACGGCGTTCGTTTCAGCGAGGCGTTTACAAACCAGTGCCACACGAGACTGAATAGACTCACCACACACACTGT
GCACGTAGCCCACACAGCTTCACGGTGGACAGTTAGCCCTTCAAAAAGGATCACGTCTCCTCCGCCCGCAAAGTAACCATTCCCCGCTAGCACCATCACC
ATAATTCCCCACTTTCCACAGCACAGCCACTCCGTTCCTTCATACAGATACAGCAAGCTGAAAGCGCACGTCGAAAACAGCAACGTCGCCACGGTCCACG
GCATCTTCACAGTCCAGCGTGCTCGGCCAACCGTCCGCTTGCACTCCACTCGTAGTCCCTTGTAGTACTTGACTAGCAAGCTCCACCCGGTCTCGAGAGT
ATCCGACAAGAACACACACCAGTAGGCGTGAAATGCGTCGAGCCACTTGTATACTAGCCGTCCAAGGCCGTCTTCATGCTCTAGACGAGCCTCCAACACC
ACCATCGGAGTGATCCATAGAGCCACATACATGTTCCACCAGCGGTCTCCACGAGGACGACCGGTCCCCTCACAAAACGTCGATAGCGGCGGACACTTAT
CGTCGCAATCTTTGCCCACTTGTAGATGAAGTAGCTGATCGCCGAGATAGGACGGGCAGCAACGTCACGGAGCGGTTGAGTGATCACCCAGAAGAGCACA
GCGCTCACTGCA