Description :
From Genome Similarity Track
Location :
Scaffold_2322:133- 1317
Sequence
1184 bases(100 bases per row)
AGCACCTCGCGTAGGCGTTTCAGCGTGCGTAGATCATCGTGGTCGTCGGTCGGTGCATTTCTACCCTCTTCGCGCTGCAGGGTCTGTCCAGTGATGTGGT
CCGCGGCCGCGTTGTAGTCTCTCTTCACATGGATCAGATCCACTGTGTCGAACTTCTGGATGTCACGGAGCGCATCGATCCAGAGCAGCTTCAGCCCAGG
CGTACGACACTCGATCTCACCACGCAGCTGCTGGATCACTATCCTCGAGTCTCCACACGCGATCAGCTTGCGGATTCCATGCTCTTCAGCGATCTCCAAC
CCCAGTAAGATACCCTCGTACTCTGCTTCATTCACCGTGACGTCAGTTATATATCTGGATCGCGCCACGACCACCTTCCACTCGGGCAATTTCCACAGGA
TCGCGGCGTACGATCCGCATCTTCGCTTTGCCTTCGCGGATCCGTCGAAAGAAATCACGTATGCTTCGTCACTAGGCCCAAGCCGGGGTAGGATCCTCGC
ATTTGGTGGTCTCATGGCGATTTTCCGTGGTCGGATCCCTTCCAGGATCGCGTCCACCTTTGCGCGTGGCGTCACCGACGCAGCGATCACTCCGCATAGC
TCGTCCTCGCCCTTGCGTGCTCTTTCGACAGTCAGATCCCACGGTGACAGTATGGCAGCCCATTGTGCTAGGCGCCCCTGCAAACCCTTGGATCCAAACA
GCCATGCGAGAGTCAAATGCCTCGCGATCACGCGTATTGGCCTCCCGATCACCATGTTGTGGCAGAGATCCAACACCTTGAGCAACGCTAGCACCTCCTT
TTCCACTGGATCGTAGCGGATTTCATGGTTTTTCAACACCCGACTTGCAAACCTAACTGGCATCAGCATGCCATCATGATCCTGTAGCAGGGATCCAGCA
ACCACCCAGTCGCGGGTATAGAGCACAATCACGATCGGTAGTGCTGGATCGAAGTGTTGTAGCAACGGAGCTTGGATCAGCCTGTTCCTGAGCTTATCGA
ACGCGGTTCGCTGCTTGACCAACCCGTTGGATCCGAGCCGGAAATCGTCCTCAGTGAGTTCATACAGGATGCCAGCGTGCACAGCGAAGTCCTTGATGGA
CTTGTTGTAGTAGTTGAGGGATCCCAAGAAAGACTTCATTGCCTTCAAGGATCCGGGGAATGGTAGGTCCTTCAGCGTCTCCAG