Description :
From Genome Similarity Track
Location :
contig_25:132998- 135490
Transcript NameFunction/comments
g4911.t1hypothetical protein PHYSODRAFT_300772

Sequence
2492 bases(100 bases per row)
CGAAGAAATAGCCGGCCAGGACGATGCAGAGAGTGGAGGCGAAGACGACCAGGAAGGAGCACGCAACGAGCGCGAGTTCCTTTTGGATACAGCGTCAAGT
CTTGGGCGCTTACTACAGCCCACGCCGTCCTATGCGTGCCAGATCGCCGAGTTGAATCTGCAGGGCAATCGTCTTGGCAGTGAGAGCTGTCGGCTGCTCT
GCGCTGCACTAGACGCTGCGGGATCAGCGTCTCCATTACGTCGTCTGAATCTCAACGGAAATCCGCTAGGACCCGTGGGAGGCCACGCCATCGCAGTGCT
ACTAGCTGCCACTACTTGCCCGCTGCAGGAGCTCGACGTGGGCAACACCGAGCTCGACGTCTCCAATCTCATTGCCATAGCGCAGTCGCTGCGTGGCAAC
CGCAGTCTCAAGGCACTCAATCTCGACAATCCCATTGTACGCACAAAAGAGGAGGAAGCGATCCAATACATCGGGAAAATGTTGCAAGTGAACCGCGTGC
TCACGAATCTAAGCTTAGCGAAGCATCAAATGACGGATCACGGCGCGCAGGTGCTGGCTGAGCGCTTGCTGGACAACCGCTCGCTACGACGACTCGTGCT
GCGTGCCAACCGAATCAGTAGTACAGGAGCCTCTGCGCTTGCAGCTATGCTACTCCACCACCCAACGCTGGCTGAATTTGATCTCAGTGCCAACCGAATC
GGAGACGCTGGCGCGAAAGCCTTTGCACAAGTGCTGCGAGCCAATATGAGCAGTCCGTTGGAGGTGCTGTCACTCTGCTCTACGTCCCTCACAGACGACG
GCATGGCAGCGCTTGCTACAGCGTGTCTGAGACCACAGAACTCAGAAGCAGGCTCACGCTTACGCTGCCTCCTGCTTTGGGGGAACATCTTCGGCCCCAA
GACGTCGCCGCTGGTGCTGGAGCTGTGCGAGCCCGGAGGTCGCTTCCACGAGTACAGCGTCGAGACCGACTTTATGCCGCGCCTTGTGGACGATGAGGTG
CTTGTTGCACACCAAGAAGCGTACCACTTCCCACGGTTCGCGTCGCCCAAGAAAAGTTAAGTTGCCTTTCACTTCAACTTGAAAATCAACCTAAACGTCA
ATCTAAAAAATGAAATCATCCTGAAAATCAACCTAAAACAATCTCGGCGCAAAATGCTCCGCCGATTCCTGTCGAGGCGCCCGCGCGTAGCTGTCCCCAT
CGTGGCTCTCGAGCATCCTGCGAGAGCGCTACCTACCACAGGATTATCCCAAACATGTTGCAATGCTGCTCACCAAATTCGGGGCTCGTCGTGCCGCTCC
TTCTTTCACTACGCTGCATGGAAAACATCGCTCATTGATGCCCGATGGTTGTCAACCACTGGTGCCCCTCCAAACGACGAGTCCTTTGCGTCCGTCGCTG
GTCATGCGCAGCGAGAGATTGCAGATATCCACGATGTGATAGCCACCACCCATACCAAGCAGGAACTCACTGAGCTGCGAGAAGAAGCCGCAGACCCGAA
TCTCTGGGACGATGCCACTACCGCCGCCTCGGTGGTGCAGCGGCTGGCTGCACTGGAGTCGAGGGAAACGCGCGCGCATGAACTGCAGCGGAGGTTCTTA
GATACGAAGGAGCTGTACGTGATGGCGACGGAGGAGTCCGACGAGCCCATGATAAGGGACTGTGTGAACGCAATGACTGCAGTCCGGACTGGTGCACAGC
AGCTCCGACTGGAACTGCTGCTGTCCCATGAGAGTGATGCGCGGTCCTGCTTTCTGGAGATTCAAGCGGGGGCTGGAGGCACTGATAGCTGCGACTGGAC
GGCCATGTTGGCGAGGATGTACGCGCGGTGGGGCGAGGCACGGGGTTTCCAAGTGCAGCACGTGGACGAGTCGGTGGGAGATGAAGCTGGCTTCCGATCT
GTGGTGTTGCGGCTGGACGGTGCGTACGCATACGGTTGGGCAAAGAGTGAAGCTGGTGTGCATCGCCTTGTGCGCATTTCGCCGTTTGATAGCGCAGGGA
GGAGACATACGTCTTTCGCGCAAGTGCGCGTGTACCCTATGGCCTCTGAGGGTCGCTCCAAAGAGGAGATCGAGATCCCAACCAAGGATCTACGTATCGA
CACGTTCCGATCGTCGGGTCCTGGCGGGCAGCATGTGAACAGCACGGATAGTGCCATTCGAATCACGCACTTACCCACGGGGATTGTTGTGCAGAGCCAA
TCGGACCGATCACAGCACCGTAATAAAGCTGAAGCGCTGGCCATGCTCCGTGCTAAGCTGTACCAGCGCAAGCTCGAAGAAGAAGCTCTCAAGAGGCAGC
AGTTCGCACAAGGGCTTGGAGACAATGCCTGGGGTAACCAGATCCGGTCCTACGTGTTGCATCCGTACCAAATGGTGAAGGACCATCGCACCAATTACTC
CGAAACCAACACAGCGCAGGTTCTCGACGGCGATATCGACCAGTTCGTCGAGAAGATGCTACTGCACCAAGCAGCATCCATCCGTGCTGACG