Description :
From Genome Similarity Track
Location :
Scaffold_165:13299- 17237
Transcript NameFunction/comments
Phyta_totarag4898hypothetical protein PHYSODRAFT_545408
Phyta_totarag4899hypothetical protein PHYSODRAFT_301465

Sequence
3938 bases(100 bases per row)
TCCGCCGCGGCGGCCTCCCGCTCACTGCGTCGCGCCGCGTCATCCGCGGCCGCGGCGCCCGAACCCGTGTTCGACAAGCGCGACGGCTCCAAGGGCGAGA
TCGACAGCGCGCGCGCCTTCATCGAGTTTAAGCGCGAAGCGGACCCATACCGCGACGTGGTCGAGCGCGTGCACGACTGGAACGAGATTAACACGGGCCG
CCGCGACCCGACGGAGCGCAAGATCCAGGCGGCGCGCTGCATGGACTGCGGCACGCCCTTCTGCCAGACCAACACGGGCTGCCCCGTGAACAACCTCATC
CCGGAGTGGAACGAGCTCGTGTTCCGCGACGAGTGGAAGGAAGCCATCGACCGTCTGCACAAGACCAACAACTTTCCGGAGTTCACGGGCCGCGTGTGTC
CCGCACCTTGCGAGGCCGCGTGCGTCGCCGGACTCGTGGACGACCCCATCACCATCAAGAACACGGAGTACGCTATCGTGGACCGCGCCTTCGAGGAGGG
CTGGATCGTACCCCGCATCCCACGCCGCAACGGCCTGCGCGTGGCCGTAGTGGGCTCCGGCCCCGCCGGTCTCGCGGCCGCCGACCAGCTCAACCAAAAG
GGGTACCACGTCACGGTGTACGAGAGGGAGGACCGCGTCGGCGGCCTGCTCATGTACGGCATCCCCAACATGAAGCTagacaagaagacggtgaaCCGTC
GTGTGGATTTGTTACGCGAGGAGGGCATCGAGTTCGTCACCAACGCCGAGATCGGAGGCAACACGcccgtggagcagctgcaggccGAGAACGACGCGGT
CGTGCTAGCACTGGGCTCCACCGTCCCACGGGACGTGGAAATCCCTGGTCGCCACCTTAAGGGCGTCCACTTTGCCATGGAGTTCCTCACCAAGAACCAG
AAGCGGCTCATTCTGACGGTGGAtggcaagctgcagagcggcTGGGACCGTGACTTCGTCACGGCTGAGGGCAGGGACGTCGTGGTCATTGGCGGTGGAG
ACACGGGCACGGACTGCATTGCTACGTCCATGCGGCAGCGATGCAAGTCCGTGGTGAACCTGGAGCACAACCCGCAGCCCCCAGACCAGCGCGCCCCGGA
GAACCCGTGGCCCGAGTACCCGCGTATCTACGGCGTGGACTACGGCCACGCCGAGGTGCGTTCCGTGTTCGGCGAGGACCCGCGTAAGTATGCGCGCGTC
ACGAAGGCGTTCAAGGGCAACGAGAAGGACGAGATCACGCACGTCGTGACCATGCTGGGTGGCAAGGACCCGAAGACGAACATCATTACGGAGATCCCTG
GCAGTGAGGAGGAGATTCCGTGCGACCTGGTGCTGTTCGCCATGGGGTTCGAGCACCCAGagcagaagatcgccgagTCACTTGGTCTGGAGGTGGACCA
GCGCCGCAACATCCGCGCTGCCTACGGTGACTACCAGACGTCGGTGGAGggcgtgtttgctgctggcgattGCCGGCGCGGTCAGTCTCTCGTTGTTTGG
GCGATCAACGAGGGCCGCGGAGTTGCGGACGCGGTGGAGAAGTACTTCCTGCAGGAAGGTTTCCAGCCGGAGGTGTCCCAGAACCAGCGCTTCGGTTAAA
TCCTGCAACGCAGCGTCAGATGACAGTGTGTACCGGTAGACAATCGCATCAACGACCCGCGTCAATCAATGCCTTATAAAGGCGTCGCTGGACTCCACAG
CTAGAAAACCAAGCTGGAAGGTATCAGCAGAGACCGACTGCCTTACGCAGCGAGCAGAGCGCGATGTAATGATGAGGGATAATTATTGTAATAGCAGAGG
TGAATCCGCTGAATCGAGTTGCATCTGCTGTTCGCTGCCGCGTGGCGGCACATTCCAGGCCACGACAAGCATGGCGGCCTTGGCATTCAATGCGCAAACA
CAAGGACATCAAGCTGGTGTGGTTGAGAATGGATGGTGCATCGTACGCGTTAGTGGATGAGACCTCTCTACATGCGGATGATGGGCACACGGCCGCGCAG
CTTAGCGACCCCGGCTTTCAAGGCGTCgctgttgttcttgttgtagCGCAGGTCCAGCACGCGAACGCCCGTGAGCTTGCCGACATCCGTCACCTTGCAG
CAATCGGACAGATTGAGCTCGTGCACGTCTCGCAATGCTGATACGTCCTCAAGCCCCACGGAGCCAGAGAGATTGAGAGTATGGACCTTGGACAACGCAG
ACACGTCGCGGATGCTCGGGCAGTGGCGCAGTGACAGCGTGTGAACCGATTCCAGAGCCGACACGTTCTCGATACGGGGGCAGTAGCTCAGATCCAGCTC
GTGAGCGCGTGCGAGAGGCGACACGTCCACCAACTTGGAGCATCCTGCGAGCTTCACGATGCGCGCATTTCGAGCTAGTGGTCGGACGTCCTCAAGGGCG
TCACAGAAGCGCAAGTCCACGTCGCGTACTCCGGCGAGGAAGCTGATGTCGCTGATGTGAGAGCAACCGGACAAGTTCACCTTCGTCAAACACGCTGCGG
ACTCTGTCAGCCCTTCAATGTCCTCGAGTTTCTCGCATCGGTAGGTCACGATTGAGTGCACCTCACGCAGCGATGACCCCAACGATGTCAAGTTCTTGCA
GAAGCTCACATCAAGTTCACGGACGCGGCGGAGGCCTTCGAGTGACGTCAGTTGAGTGCATCGTGACAGCACAAGTCGATCGAGTGGCGGCAGGTTCCGA
AGCTCGGAGCTTGCAAATCCCGTGCAACTCGACAGATCCAGCTCGCGTAGACTAGAGCTCGCTCCCAGAGCGGTCAAGTCCGTCACCGAATCGCATTGCC
GCAGCGATAGCTCTTGTACGCCATTgcccagcgccgagatgTCGTTCACGTGTCTGCAGAGCGCGAGCTGAAGCATTGGCACGCGTCCGAGTGCCCTCAC
GTCGGTGACGTTGATGCATCCCGTGAGATCCAAGTCTTGCACACCACCAAGCGCCGAtacgtcgacgatgccggAACATTTGCGCAGTTTGAGCGTGTGC
ACTTGCCCAAGTGCGCTCACGTCCGTCACATTGATGCAGCCGGAGAGGTTCAGCTCGTACACATTGCCGAGCGCGCTCACATTCGTGACGTTCGCACACC
CACCCAGATTCAACTCTTGCACGTTGCCAACAGCGCTCACATCGCTCACCTCCGGACAATTCCGCAGACTCACGCGACGTACATGACTCAATGGACTCAC
GTCACTAACTCCTCGGCACACGTTGAGCTGCACAGACTCACATTTTGCCAGTGGTGCGAGGTCTGTGACAGCGTGGCAGTACGACAAGTCAACGTGttgc
gagctgctcaagaacgaTACGTCCTCCAGGAAGTTACAGTAGCTCAGGTCCACCTCGCGAATGCCCGTCAACCAATACAGTCCGTCGATctggctgcagc
cactcAGTCCAAGCTCCTGCAAGCGGTTTACCCCGTCGAACAAGCTCACGCGCGCGATTCCTGACAAATTCAACCGCTTCACTtggccgtcgtcgtcgcc
gccgtcgcagATGCAGTTTTGAAGCACTTTCGGGCAGGTGTAGCGCATCGGAACACTCACACCATCTTCGTCCGTGTAGCTTTCATTCGCCGCTTGAGCT
GGCTCAGACTCAGGTGCTGGTTGgttgagctcaaggtcaacAATGAGTCCGCCGGTAGCGTTCACGTTATAGTGGATATTTTCATGCAGTCTGCCGCTCT
CCGGGTCACCACCGACAGGTTGGAATGCCACGTTTCGGAGGTTGCGCCACTTGGTTAacactcgcagcagctctttAACAGTGCAAACCAGCGTTGCCTC
GGATCGTAGCTGGACATGTTCGTGCACGACGTCGtagaaggaggagctcaattctgccagcgccaccgcctcgTTCAGTGTCAAAAATGGGATCAAGTGA
CCGTCCCAAAGCTCAATGGGCATcgtgtgctgcaggtg