Description :
From Genome Similarity Track
Location :
Scaffold_287:13297- 15762
Transcript NameFunction/comments
Phyra_97155casein kinase II subunit beta putative
Phyra_97158GF20238

Sequence
2465 bases(100 bases per row)
GCCGGTGTAGTACTCACTGGAGCTGTGGATCTTGTAGCCGAAGACGCGCGGCACATACGTCTGCGTCGGCGGCGCCACCACGAGGTGGGAATGCGTCATA
AGGAACACGTGCGGGAACGTCGCGCCAAAGTACGCGCCATCGATTTCTGCAAATAAAAGTCAACAACAACATGAGCCTCTCGCACGTCAACTCAGCCCCC
CCCCCTCTCCATCTTGCAACGTACGGCCCGCCCGCTGCGACTTGGGGAAGAAGATGTCCCTGCACTTGGGGCAGAAAACATTGACGGTCGTGTGTCTGGG
CACGTCCGACTGGCCAACGGGAAGCACCGGCTGCCCTTGGCAGTACACACGATGGCAGCGGCCGAAGTCGACGTTCTGGTACTTATCAAGCATGGCGGCC
ATGCCCTTGGTGGTGAGGATGTAGCGCGCGTGGATGAGTCCGTAGAGCATCTCTGCGGCGGACTCGATCATCTCCTGCTGGATCTGCGTGAGGCTGCTGT
CGTTGGGCGTCTCGATGTCCAGGATGATGTCTAGCGCGTAGTCGTAGTACGGGACGATGCTGCTCAGGCCCGTGAGGTTGAAGTCGTCCTCGATGTAGTC
CTCGTCCACCTCGCACAGAAAGCTGTTCTCGCGCAAGGAGCAGAACCACGCGATCCAGCTCGTCTCCTCCTCGTCGCTGCCCTCCACGTCGTTGTCCTCG
TCGTCGTCATCATCGTCCTCGTCGAGCGCGCTCGAGTCCTCCTCCTCCTCGTCCTCATCATCCTCCGAGACGCTGGCAGACGCGCGAGCCGCCTCAGACA
CGCGCAGCTCCTCCATGTGGCCGAACAGCCGCTCCATCTCGGCCTCCTCCGCCGTCTGCGCTGGCTGGCTCATGATGCGTCCCTTTGGCAAGGAATTGCA
GGGCCTAACGGGAGCTTTAGAGCGCTGCGAGAGCCGCGTTGCACTCGCTCGCGTCTCTGGATCGCTCCTCTGGCACGAGAAGAGCGCGAAAGGGGATGCA
CGCACAGATACACTGCGCTGCTCTAGTCGCACGCAACCTGCACAAAGGTCCGCCGTCGCTTTCTTCCCGATTAGAGCCAAGCGCTGGCTTGGAGGCGGTC
GGATTGAGGGTACCGCTTTCAAGGTACATTGTGTGGAATACGTAAACTCTAGCCATTTTGGCTTCATACATTGTAGCCATTTCTACAATGGCCGCAGCGG
ACAGTTCCTCGACGACTTGGTACGAGGCCTACGCGTCTGGGGATGAAGCACGGCGAGTGGATGGAGAGGAAGACGGAGAGGAAGAGTATGAGGAGGTGGA
GGTAGAGGAGATGACGGATGACGAGCCCATGCACATCACGGGGCGTCTGTTCCTCGGCTCCATCGACGCCGCCAGGAACATCAGTGCACTGAAGCGACTG
CGCATTGGGGCTGCGCTTGCGTTGCTGGGGAAAGGGGAAGAGGGCGCAGCAGTGCCGAGCCACACAAGTACAGTCGCCGAAGTGTACGCGGAGTTGCAGA
TTGCGAGGAAAATCGTTGAGATTGAGGACTCGAAGGACGGGGACTTGCTGCGGAGACTGCCTCGGATCTTGGCTGCATTGAAGAAGCTTGTGTGAGGAGC
TGGATTAGATGTGTTGCTGTAGTATTGTACAGATGGCGGGCTGACGTTGTCGTGCGCTTGGATGCTGGCTGAACAGGGAGAAAGTCGAACATGAGAGCAA
GAGCGTGTTGGTGCATTGGTACGTTTGTCACTGAGCTAAACACAATCACTTGCGTTACGTTTTCGTATTAGATGGACATACTCACGGACTTGATTGCCTT
TTTCAAACTGCAGCATCGCTGGTAGATCACGCTCTGCCGCTGTTGTGGCAGCGTGGATGCTCGTCAACAGCTCGGAGCGACAAAGTGTTCAAGATTGTGT
CGATCAGATCAGGTGAGAATGCGTGGTGAAATGATTACAGTTCTTTGCAACTGTACGCAGACATTGGCCTAACAGAACTTCGCATTCGTCCCAGGATCAT
CCGTCCGTGGATTGAGATCAATCCGCATTTCATACGAGACCTGCATCTGTTCCAGGCCATCCTGGCTTCGACCCATGGGGCATTACTGAGTTCGGAGAAA
ACTGCGTTGCTAAAGGATCGATCTTTCCCGCGATTGGACTTCGGTGCGAACCTCGTCGAAGGTGTTCTCCAAGGCACGAAGACGATCACGATGCGCTTCT
TGTCCGATGTCGAAAGTGATCACAATTCGGACTTGAAGGACATCCACCTGTTCTCGCTTGTTGCAGCAACGACCTCAAGCACAGATGACACCTCGATGCG
GCCGCAGTTCGCTTACCTGCGGATAGACCAGATCGAAACCAAGGAGCTGAGCGGCATCGACGACACTACGCTCCACAAATCTGGATTTGCGTCAACCGAT
GAGGTGATGGCAGTTCTGAAGCAGTTCTACCCGAACGTGACCGCCACGACCCCATTGCTGATGCT