Description :
From Genome Similarity Track
Location :
Scaffold_86:13296- 15474
Sequence
2178 bases(100 bases per row)
GAGTCACGCGCCCACGAAGGAGCCTTGTACTCGTCAAGTCTCTCGCTGAACTCATTATCATTCAAGCGCTCGTTGATTGGCATCACGAACTCGTAGCTAC
TGAAGACTGGTCCCGCGTACATGATCTTGTCGACGATGAAGAATCCCATGTTGATATCACCGACACCCACGTGCAGTACTCCGCCTGGGTCACCATGCTC
CACTGAAGGAGTGTCTGTATGAATGTCTGCAACTAAGTGGTCTCGTTTACCTGAGTCTTCGCGGTGCGAGTAAAACAGGCTGGGATACCAGCCGAGGTAA
CGAGATGCACCACTGCCTCGTCGCTCTTCAATAACACTCTTGAGGAAGTCATCCTGTTCTTCATTGAGCGTCCGCTTCATGGACTGCGAGATCGAAATTT
CAGTCAGCTTGCGCATCACATCGACGAAGTTCTCGAAGAAATACTGAGCCTTGTACTGCAGTGCGGACTCATCATCTTCGTCGTTTGAGGCCTCTATGTT
AAGAAGCTTCAGCCTTGCTACAATATCAAGTGTCTTCTCTCCCAGTTGTTGCATTCTAGCCCAAAATGACGGGCACGGCTCAACAAACCCAGCAGCGTAC
TCACAGCGAGTACCCATCGAAAAGCTTTGCTTTGCATACAATATCGTGTCGTGCCGAAGCTGCGCAAATGAGGCAAGTTGAGTGTTCATCACACGCGCTT
TCCAGGCGTTGGAGTGAAACACTGGATCGCTGCTGACACTAGCCTGGGACAGCCCACGAAGGGCTAGTTGCCACAATAGCGCCAAACTGGCTGTCGCAGG
GTCTGCTTTCGCCATTTTGTCATCAATGAGCTGGCGTAGAGCAAGAAGGTTGGACGCATATGGCACTCCATCGCGGAAGGAAACAAAGTCGGGGTATTCC
GTCTCACTCTTCGCTGCCATTCGCTTGGCAATCTCTTGTCCTGCTGCGTTGTTACCATATAAAGCGAATATAGCATCCAGAGCACTTGGAATGCGTCGCA
CAACTTTGGTTTGCTCATGGAAAATCTGATCGTAAACAAGTTTTGAAAACAGGAACGCACTCCAAACAAACTGTTGTCCAAGTAAAGCGAAGGAAGTCGC
CAAGCGAGTCGGTGTTGTTGGCGACTGAAGAGCAGCGGCCGACTCAGTCGTCGGGTGACCCGCAATAGCCTGTGCGCCGAGTCCCCGTCTCGCGATCtCT
TTTTGGAGTTGTTCAAGACTGGAGGTAGCGGTCGGGGCATCAAAATATGTCGCCAGAAGATCGTGCTCCCcAAGAACGTTATGAAGCTCGCTTGGTGTCA
TGTTATCCGAGCCGGGACCGTCACCTGTGATCACTGCGATGATGTTGTGCAGCGCAGACACCTGGTCGAGAACAGTCGCCTCTCGTAGAAGGTGAACGAG
CAATACAGCGCACCGTAGCTGTCGTAACTCGCTGGTCTTGTCATCAGTGCCATCAACTCGTAAGTCGATGGTGCCCAGCCAAGTCAATGCCCGGAAGTAC
TGCTTCAGAGCATCACTCTTGGTGTAGTGGCCACGTGGCTTGAACAACGAAAAGTCAACTTGACGCGCGCCAAACACTTCTATTGACGTCAACTCTTCGG
CATTGATAGCCGTCCAAGTCATAGCCAAGCGACTGTTGTTTCCTGGTATGACCTTCTCATCTGACGGGGCTTCACCAGACAGAAGACATTGAGCTATCGT
GAGAAAGTAATCTGCGTCGAGCAGCGTTTGCTGTAGGTCTCCAGACGAAGGCGCCGATGCGTGAAGCGCTGTACACTCAGCAATACTTTTCTCGAGAATA
CTGCTCACCATCGGCATCAGCTCCTCTTCTTCTAGCTCCTTCAAGAAAGCATCGAAACTGCGATGCCACGCGTGAAGCACCGAATCGCTGGTGACAAACA
CGGGCATAtCATCACTGTACAGTCGATAGTAGATCTCGGCAAAGCTCTCCGCCTTCAAGCGCTCTGACACGACGAAGCCGAGGGATTTCAGGCGCGCGGT
CTCTTCATCGTTCAATCGGAAGTCGTTTTGGCGGTGCTTCTTCAGCTCATGGTGTCGATCTGATCCCATGACACCCCGTACGAACTTGGCTCCGAGCGTC
TGCTCTGCTTGGCGACGTGTTTCATCAGCCAGTCGATTCGCTTCCGCAGGGCTCGTGGCGAACTCGCTGTAGAACTTG