Description :
From Genome Similarity Track
Location :
contig_100:13296- 14695
Sequence
1399 bases(100 bases per row)
TGTTGCCCATCCCAGGTCCCAATCCATCCATCCGCGCCCATCGCCCAATCACCTGGTCGGAAATGATCAATCCATCACCAACCCTCTGATCACTTCTCCA
CGTACACTCTCGTATTGTACGACTTCTATCTTTCAAAACAATCCTGGATTCCTTTACAACACACTGCGGGGTCTGCTACATATATCAGGCCTTGAACTAG
CATTACTTTCATTGACGTATAACTGGGCAGCAGCTCCGGTGACTTCACCATTTGCGTACATCAGACCATTTTCGCAGCGATAACATTGTTTCCAGGTGTT
CACCAATTAGTGCAGCAATGAATACCCGATGATTATCACGGCTGTTGGCTTGTGTCGAGTCGTCAGTCAAGTCAGCAATGGGTTCTCCACTAGCTAGGTT
ATGGCAAATGTAGGCGTTGTTTCTTGTAATGTCTATCCTTGCCATTGCTAACTTTTTGTGCCATTTTTTGAATAAATTCCCGCCCGCGATAAATAATCGA
CTTCGAGTTGATCATGACGATCAACCCTCTGCATGGCAATGTTATATTTGCGCATGCAGACCGGAGCCTAAAATCCCACTCGTTTTTGCGCGATTCTACG
TAATACCGCTATAGTACCCGATTCGTCGGCATTAGACACAACGTTTACGATGGACCCGTCCACTTAACTTGCAGCAACGATATTTCTCTACCCAAATGCC
TTGATTCATACCCCCTCGCTCTTTGTCTAATTTCGGGTCTAGCATAGTGAAGTGAGGGAAATGGTTACTGGCTGATCTAACTGTGCTGCGGTCATGCAAA
CCCACAGATCGTAAGCTCTCAATGAGGAGACAATATTTATAAAAAAATGTCCGTATTGACAAATCGACGTGACTCTTGCAGCGTGTTTGTCACTTCCAGC
ACATGACGTCGGATATCAGACGACTTCTTCGTGATATCGGCAAGACGGTCAATCTGGGAGGTCTCAATCATACCTCCCAATATATCGTGACGTTCACTAG
CGCAATGAAGCTTAAAATTCACTACGAGCCAGGTAGTGGAGCAACAGCACATACAGCGTTTGAAGTGGTATTATCCGGGTTATAAATGATATGTCTCGCG
TACTTTGAGCGGGATACGATACTGACCTCATCGACTGCTACATTCCGACCCACAACAACATTGCGCGTTCAGCGTGATTTTAGCATGGTACGCAGCGGGC
GGATCCTTGCAGCAGGACCACGCTGAACTTCAGCAATCGTCACTTCCGAGCGAAATGCCAAATTCTTTCGAATATACAAGAATCGATGCCACGCCATGAT
TGAGTCCAAGTTAGCGAATAAAGCCCAGGAAATATTCTTGCTTCCTCATTGTCTCCCCAGTAGTTTATCATTTCGCCTGTGCCCACTAGAGCCATGTGC