Description :
From Genome Similarity Track
Location :
Scaffold_217:13293- 22602
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_217-snap-gene-0.17Gene of unknown function
Pytve_DAOMBR484maker-pve_contig_217-snap-gene-0.18Nup133 nucleoporin family protein
Pytve_DAOMBR484fgenesh_masked-pve_contig_217-abinit-gene-0.41Kinesin K39 (ISS)

Sequence
9309 bases(100 bases per row)
ATGGCGGCCGAGATCGAGCGCATCGTGGACCGCAAGCTGGTCAAGCAGCGCGTGCACTACCTGGTGGTGTGGCGCGGCTTCGGCGAAGAAAGCAACACAT
GGTGCGTCCTTCGCCTGCCTGCCTCGTGCTTCTCCCTTTTGCTTCCCGAGCTAATGCTGACGATGACCGCGTTACAGGGAGAGCCGTCTGGACCTGATGG
CCGATGGCTACGGCCCGGTGATCAAGCGCTTCGAGGACGGTGCGTGGGCAGTGTATGCTGGTTCATTTGCGGACTGTGCTGACTGGTTTGGGTCGGACAG
CGCGCAAGAAGGAGGGTGGTGCCACACCGTCTCGCGCGCGCAGCCGCAGCCGCAGCCCCGGACGAGCATCGTCGACGCCCAAGAGCCCGCGGAGCCGGAG
CCGGACAGGCCGCAGTCCCGGTCGGCCGCGTGGCCGCAGTCGCTCGCGCAGCGCGTCGGTCGGTCGCCACGAAGAGCCGAAGGAGAGCAAGCCGAAGAAC
TCGAAGACGACCAAGGCCAAGAAGACCAAGGAGGAGGCCAAGGAAGAGACGGAAACGACCCAGTTCGTGACGCGGATGGACGCTGAGCCCAAGGATGAGG
AGCAGAACGACGTGCTGCTGCGCTCGACGCTGGCGGCGCTCGCGCCGGTGGTCCGCGAGCAGCCGTCGGTCGTCAAGGAGGTGACGACCACGACCGTCCG
GACGACCGTGGCGGTCGCGTACGAGGAGGAGTCGCACGCAAATGATGAGGACGAGAAGCCGCTGCTGCGGGTGGCGGCCCCGCGTGCGACCAGCGTGCTG
TCCACGCTGACCAAGCGGGACACGGTCGTGACGGTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTCGCGGCGGTGGTCGCGTCGCTTGTCGTGAG
CCAGCTGCAGGAAGAGGAGGGCGAGCCCGCGCTGTGGCGGAGGGCTCTGCCGGCGCTGATTCCTATCGTGGCGCTGCTGCTCTTCCTGCACCAACGCGAC
CCGCGCGCGTCGGCCAAGTGGGTCGCCATCGCGCTCGCGTGGCGCTGTGCCGCCGAAACGCTCGTGTTGCTCGGCGACTTGCCTGAGGACTTTTGGCTGG
TGGCGCTGGCATCGGGTGGCGTCGCCAACCTTGCGTTGCTGATCGCGTTCGTCGCGGGAATTCGCAGCCGCGACCACGTCAACGCCAAGGCTAGCTTGGT
GCTGTTGGTTGTCGGTATCGCCTCGCTCTTCCTCGCCGACAGGTACGACGCGCGTCGAGTGGGTGCGGTGGATCGTATCCAAGTTGACTCATTTCGGTTG
TGTATGGTGCAGTTGGGTCATCACGACCAAGAACCCGGCGCTCGAGTCCCGCGTCCACCTCACGTCGGCCGCTCTGGTGAGTGAACACTGCTGTCTATTG
CGAGGTATGAGTGCTGGCAACTCACGAACTCGACTCAAAATCGATCGGTGTGCTGCACAGCTCGCTCTCGCGCTCTCGCCAGTGCCAACTGCCGCGCGTA
TCGATGAAGACTAGACGTTAAGTTCGCACATCCTCTTCCAAGCTGGCGCGGAGCACTTGTTGTCTCCGTCAGCCAGCGTGTTTATTCTCCGCGCGGGGCA
CGACGACGATGCTGGCGGCGACTGGAGCGGGCTGGTTGCACCCGCAACCGGTCAAGTCCGCCTTTGTCCGTCAGTCGATCGCACATCGGGTCGTGTTGTA
GGCTAGTATGACCTCGCTCTTTCTTTTGTCGTGGCGTAGGCGCCGAGACATCGCCGAGCGGCAAGCTCGGGTCTGTTTCACACGCGCTCGCGGGGTTGGC
AGAGCGTCAATCTCACACGAAGTCTGTTTTATTGCATCTCGTCTCACCGCCTCACGCATACTGCGCCAGCTGCAGCGTCTTGACAAACAGCGGCAGTGCG
CGCTGGTTCACGATCGACTGGGGGTCGCGCTCGCGCCGCACGAGCGCCTCAAGCAGCTCCACCGACACGGCGCTCCCGGCTGCCTTGTTGTCGTGCGCGT
GCTGATCCATGACTGTGAACAGCAGCGTCTGTCGCATGAGCTCTTCAACGGCTGTCTCGCTTACGTGCGTGTCGGATTCCGCGATCATCTGTCCCCACAG
TGCCTCGTCGTGGCACAAGCACGAGCGCCAGACGTCAGCGAATGCAGCATCCACCACGTCGCGGGTGATCGCTGGGTCGGTCGCCAGCGTCTCAGCCGCG
TCAAGCGTCATGAGGAAGAGACTTGTTCTGCATAGTCACATAACTCCCCAGTCAAAACAAGCAAATCACAGCAAACGATGTCAAGACGTTGCCGTACCGG
AGTGGGTCATCCTTGGCCACTGACAAGCTCGACTCGAGACAGGCGTGGACGAGCGCCTCCGGTCCTAATGGCTGCGCGTCCACCGCGTGTGCTAGCGGTA
GCTGCAGCAGGATCTCTTGAATCTTGCCGCGCTTGACCTTTTCATATCATCACGATCCACGATGTCAGTTTCGAGGACATCCAACACTTAGCAACAGAGT
CGACTCACCTCGCGGTCGATGCGCTCAGTCGTCTCGCTGTCGACGCCCGGTCCGGCTAGCGCCGCGATCTTGGCGATGCTGCTCATGGTCTTGCGGTCAG
TGAGCGACCACTGCTCCGCCTCGGCCTCGCGCAGCGCCAGCGTCGCCGCCTCGTCGAATCGTTCGACGGCAACCGCCGTCATCCACCGGTACTTGGCGAG
CTGGTCGTGCTCCTTGACGAACTCGTGCAGCGACGCGCCAAACAGCGCCGAGTTGGCCAGCAAGTATGCAAGCATTGAGCTCCCATCCGACTGCTGGTCG
ATATCGTCCCTTGCCCACGGGTTGGTGATCTCGCCAGTATACCACCGGTACACGAACGCGTCGAACGCGTCGAACTTTGAGCAGTAAGCCTCGAAACGCT
TGAGCGCCGCGCTCTTGGCCGCCTTCCCGAGCACGTAGTCGAGCTTCTCGAGGTTGCCCCGGTCTTCAGTGAACGCGAGGAACACCATTCCTTCGTAGTA
CGAGTACGTCTCGCTGAGACGCACGCAGGTCTTGAACAGGTCGGATCGCTGCCGCTCGACAGCGTGGGTCTGTTCGATAACGTTCACGCTGCTTCCTCCG
AGAGACAAAGGCTCGGCGCTCTCAGATTCGCTCGTGGCCACGAAAACGAGCGGGTTCAGCACTGCACGCTTGGCCACGTCGAGCTCCCTGCGTAGGTCTT
CGGCTTCTTCGCGGCGAGACGTCGGAAGGAAGCGCATGTAGCTGTCCAGCAGCACGACACCGAGGCTTTGGATCTGGTCCGCAACCTCAAACACATCGTT
TGCAGGCCACTGCACTTGCTTCTCGGCCGCAGGCGATGTGGTGTATCCTAGCTGCTGCGTAAGGCGGACAATGTGGTTCACGACAACTTCGCGCACCTGC
CGAGTGAATGCCCAGCTGCCCGTCGGCGCGAACACCTGCTTGTCGTCTGCAGGCGGGAGCCGAATCATACACAACATACTGTAGCCACTTTCCAGCAGTG
CGTGCAGGTATGCCGGGGAACTGTCACCGATAGAGGTCGCCAGCTTGTCCAGCTCTTGGTCGAGCAACTGGAACAGCTCCGGGAGCTTGCTCACCTCGCA
GTAGAACACGTCGAACGCGTTGTACCCCGCGAGTTGGAGCTGCTCCTTCTGATAGCCACGGTGCTCGACAGTCACTTCAATCGCGTGAAGCAGAAACTGC
CCAGTCAGTCGCTGTTGGATGCGCTCTGCCTCGGTCGCGACCCCTGAATCGACAGCAGTCTGCTTTCGCGACAGAATCGACGCCTGCAGCTTGCTCAGAG
CGATCGCCGCGCGCAGCTTCTCTTCGTTCTCGAGCATGCACCGCTTCAGATCGGTCGAGTTCTCAATGAAGGTCCACACGGACGGACATCGCCGCTGCAG
AAAGCGAGCAAACTCGACGTGGCGCGAGCGCTTCTCCTCGAGCTGGTACTTGACGAGCTTCGGCGTGACGGTAGCAGGATCCGACGCAGACATTGAACTC
ATTCCATCCTCGCTCGTGGCGCTCTGGTCCCATCGCAGACCCGACGACGGCTGCGCGTCCAGGATCTGCATATCCAGCGCGACCGAGGCTTGGGCGACAG
TGCGGATGTCTCTGCTCGCGACGCGGAGAGCAGTCGTCGACTGTGGATCATGCTGGAACTGCTCGAGCAGCAGTCCCACATACTCCTCCACGTCCAGGTT
CTCGGACAGATGATGCAACGGCTGATTCGACAAAATGCGTCGATTCTCTGCAAGCCGCGCTCGGTTTCCGCGTCCTGGAGACGGTTGCTGAGCGACGCGC
TCGACACTCTGCATGTTGGACGCCGTCGCCACACAGAGCGACCCCGACAGTGCCTTGAGGTCCGTCTCCATGAGCAAAAACGACACCGAGCCCTTGACGC
TGTTGGTGCTCTGACCGTGAGAAGCGTTGCTCGAGTCGTCGACCCGTGCACCGAACGCATACGTGAGCTGCTGGTTTTGGACGCCTTGCAGCGAGAACGC
CGCAGATCGCACACTTGAGCGTCGCCCGCGCTGCGGAAGAAGGATGGTCGAGAACTGGATGGGCGATGCGGCCGTCCAGACGAGGTAGAGCGCGTCGCGG
GTGATGCCGAAGCTCTCAACTTGGAAGAAGCGAGCAGCAGTCACACTCGTGTCTCCATCTTCTGTAAACACGGGTTCGTAGTCGAGCACACAAGCCCACT
CGGGTTCGGGCGGCCCATCGTCCAGCGAGTCGAGCGCGAACTGGAAGAGCACGTACTTGACCTTGGCAGTCGAATTATCTTTCGACGCGCACACAAAGGC
GACGAGGAGGGAGAGACACGTCTCGTTCACGTACGGGAGCGCGACAACAGCGATCTTGGCGAGGTGGAAGTTCGGGAAGTTGTCGCTGAAGTAGCCGATA
GCCACGCGGCTCGCGTCAAAGTGCCAACGCGACACGTACGAGCAGTCGAGCACGTCGCCAGTGTTGAATTGGCGTCGCTCGACGATACCGCTCTCAAAGA
GCACGACGAGGTCGGCCGTTTCGCTGTCAACCAGCGACTCGACGTCCGAGTCGGCCGTGTCCGCGCCGCCGTCTCCACTCTCCGATGGCACGACCTTGGC
GTACTTGATCGGCTGGTGCGGGTCGCCTTCAAACGCGCCGGCACCAGCGCGCGTCGAACCCGAGAAGAAGAATTGCGTAACCGACTTGGTGATCCCCGAG
AGGAAGCCCGCGTTCTGCTTCTCGAACGCGCGCACGCGCAGCCGGCGGTCATCCATGGCCACCTCCCACACGCTGCCTTGGTTGCTCCAGCATACGACGC
CGGCGAGATCGTCTGGGTTGCTGGCTCCACTGTTAAGCAGAGCGTCGGCGTGGGAGACCACGCGCTCGCCGGGCTGCAGCGGGATCTGCACGCTGAGCGG
CGCGCCGTCGTAAGGCCGCTCAATGTCCTCCCAGAACAGCACCGAACCGCTGCGGCCGACCACGAGCAACGACAGGCTTGGAGCATACGGGCTCAGCAGG
AACGGGTGCAGCACCTCGTCGGCCGCGAGCTCGTCCGGCAGCGGCAGCGTCACCACCCGGCCCTGCGTCGGTTCCCACAGCAACAGCCGCGTGCGAACCA
CGAACGCGTACCAGCTCAACCCCATCGCGCGGCAGGCCACGACCGGCGGTTGCGCGTACTGACGGCGCCGCATNNNNNNNNNNNNNNNNNNNNNNNNNCC
GGCCACTCGCAACGCAGCTCCTCGGCCACGAAGGCCGGCAGAGCCGCGGCCACCTCGATCGCGCAGGCGGGCGAGTCGACCAGGAGACGGGAAGCGGTCG
GCGCGGGAGGCGGCGCGAGCGCGGACGCGGGGGACGGCGCCATGTACGGCGCCACTTCCAGCCGCTGGCGCTTGACGCCGAGCAGGTCCTCCGCCCTGGG
GCTCAGCAGCCCCGTGCTGCGCTTGGACGGCACCTCGACCGACTTGCGCGCGCGAAACATGGTCGCTTTCCCCTTTGGCCAAATCGGCTCGCGCCTTGCC
CACCCAGACAGCAGACAAGGTAATTTACGGCGCGACGATTATCTTACGTCAAAAGCGTCATAAATCGAATTGAACAATTTGGAGCAAAGTCGATGAAGTA
CGGACACATACTCAAGCTTTTATGCAAACAATCGAGTATATTTCCCAAATTGCAAGTATTTTCGCTCATTTCTTACCACTAAGCCATCATCAATCAAGCC
GATATTGGGCCATTTGTCAAAGCGGATTCTCCATTCATTGCCTCCTAGCACGCCCGACACTAGCAACGATGCCAATAAATACGTCTTGAGCCAACATGCA
GGCACTCCCGCGCCTCTCCATCCACCCGAGCCACGGCCACCAACGGCTGCGCTAGAACCTGCCTGTGTTGAACACCGAGACGCTCAAAAGCCGAGCGTAG
CGCGCTGCTCGCGAACGGCGAGCTCCTGGGATGCCGGCGACGGAGCGTTGTGCGCGCTGTCCGTTGATCGAACGCTGTCTGCCTGGCCCGGTGCCCTGCT
GTCAGTCGACCCGCGGATCGGAGCCTGCTGCATGAAAATCGAATGCGCTTGCTCGAGCGCCGCGACCCACCGCTGCATGTCTTCGCGGTTCTTGGCGCCA
AGCCGCGTCTGGTGGGTTGCCGAACAGATCATGAACTCGCTCGCCTTCCCCACTTCTTTGCCGTGCACGATCTCAAGCGACGGGATGTTGAGCGGGATCG
CCCCACGCGCCTCGCGGTCGCCCTTTCGCTTGTAGTACCGGAGACAGCCAGACGGGTCGATCACACACCACCGCTCGCGGACACCGCGCAGTGACATGTT
CCCGAACATGCCCTTCTCGTTCGAGTGGGTCGGGTGCTTCAGAAGCATGCCGCTCATGGTCGGAACGCTGCCGTCCTTGACTACTGTAGGCTGATATGAC
TCAACCGACTGCGGCACCGACGCCATCGACGCGCTGCTGCTGCTGCGGTTGAACAGCGGCAGATCGAAATGCTCCGACAAACGACCTCCAAACGACGGTC
GCACGTCAGGCAGACCGACTGGACCGCTGATGGACGGACGGACGTATGAGTCTCCCACTCGAGCCGACACGTTCAGCGTCTGGCTGGTCAGATCTTGAAA
CTCGTCTTGCACAACCTTCATCTCGTCCTTGAGCTTCAGGCGCCGCGTCCGCATGTCTTGAGCCAAACTGTCGTTCTTCTCCGCGGACGCCTTGGCGAGC
TGGGAGACCGTGTCGTGCTATCAAATTGGACGATGAGCATCTCGTCAGTTGCTGAACAATAAAAAAGAAGCAACGAGGATATCGAGCTCAACGTACCAGC
AATGTCTGCAATCGCGCCAGTTTGCTCTGAAGGCGAGCTGACTCCGAAGGGCGATCATACGGCGCCACATCGATATCAACCGTCTCCTCGCCGCAATCAA
GGTCCAGGATGCTCGGACCGAACTCCGTCACGCCGCGATCAATGCTCGAAAACAAGTTCAGCTCGTTCTCCATCCGCTGCAGCTCGTCCAGAGCATTCTT
CAAGTCATCCTTCAGCGAAGCACGTCGAAGCAACAGGTTCTCAGCTTGCTGTGTGTCGCCAAACTTGTGCGCTCTTGCGATACCTTCCACTGTTTCGCTC
TACAGAACAAGACCCTGCGTTAGATCAAACTGCAAAACACGCATGAAACTGCGCCACCAATTACGTACCAAGTTCTTCCGGAACATCCCAATCTTGTTCT
CCAAGAACACAAGCTGCGGTGGACGATGACCGCTGATCATATCGTCCTCACGCCTCGACGCCGCTGCTGCCACTGCCATCTGCTTCCGGATTTGAGAGAT
CTCGGACTCTACAAATTTCGATCGCTCTTCTTCCATGGCCAGCTCTTCTTTGTAATGAGCCTGCTGTTGCTTGATCTTGTCGAGCAGCCGTTCACGAGCA
TTCTCGGCGCGAGTGTCGATCGAACCGCGCTGCACCATTGAGCCAAGAAATGCCGGCGAGAAGAACTTGATCTCATAAACGCCGCTTTCAATGTCAAAGT
CGGCGTACTCGTCCAGCTCTTTCTGAACCACATCCAGCGATTCTTCGATCGCGACTCGTTCCTTTTGCAGCTCCTCGTTCTCGCCAATAATCTCAGTGAT
CTCACTGTCCAGAGCGGCGTTCCTCGCAACCAGCTCAGCACTCTTTGCGACTTCTGGGGACTCGATTTCGCCAGCTTCTTGCTGCTTCAGCTGCTCAAGC
ATCTCCCGGAGCTTCTCAGCTTCTTGGATCAAGTCCTCGCGCTCCTTCTCGAGACCGTGGTGATACGTGTGCAGGTCCTCGATTGCTGTCGCCAGCATCT
CGCACTTGCGACCCAACTCCATTTCTGTGCGATGCATCCTCTTCTTGGATACCTCCCACACCTCGTGATGAAGCTCGTGAGCCACCAAAATTTGAAAGTA
CTCCAGCTGGAGATTGCTCTGCATCTTCCTTGCAGCACGCGCCTCGATTTCCTCTTGAGTCTCTTCTTCAGGGGGCTCCTCCTTGACCCGACCCTATCCG
ATGCAAAGATAAAACAATAGTACACGCGTAAGCTACGAACCTGCTGGTCACGGGCATAACAATCAAAGCAACACCCACCACAATGCCCTTCGTAGCGTCC
GCAAACTTGATGCTCACTGGTCGCGGTACTCGACTGAGCAGCTCGAGGATCTCAGAGTATGTGTATCCCGTCAAAGTAATACCGCCCAGCACGGTCATGC
GCATCCCCACTTGTAAACGCCTAGGCAAACAATAAGCGTTAGTACACGAACGAACAGACAATCAAAGTGCATTGGCTCACTTCTCCGGCTTGACGCCCCA
ATTGTAAATCTCGGCTGGACTTGCCATGCCATTTGGCAGCTATCACAGTGTAGCGACTTCATCAGTATCCCCCAAACACCACCAGCTGAGCGAGAGCCAT
CCGTTCACCTTATAAATCTCCGCGATATGAACTGGCAAGTCGGTGAATTCTGTGCCGGGAAGTCCTGCTATTTGCTTCAGGTTGAGACCGAGACGTCCAG
GCCCGAATGTCACCTCAATCTCGTGGACCCAATGATACGTGACACCTGGAAGTTCACACACACACAAGACGAGTCAGTCCCGCATGATCGAACAAACCCG
CGTTTGAATCCGCACCTGTCTTCATCGGAGGACGAAGCCACTGTGTGTGTCCATACGGATTCACATAATATGTCTTTCCGTCGTTCGTCTTGGACTGGCG
CGTCGTCCAACCCTTCGGTAGCACCATCACTTCGCCGGACTCGAGCATCTCGGCCGATTCGCATGGCAGCCTGAACGCCAAACATTACGGAGTGTGTTAC
ACCGTGAAC