Description :
From Genome Similarity Track
Location :
Scaffold_105:132900- 134611
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_11050U4/U6.U5 trisnRNPassociated protein putative

Sequence
1711 bases(100 bases per row)
CGCTTGGCGCTCGTAAATGAGCAAGTACGACTCGGAGATGCCAATGAGCTGCGGCATCGTTTCCTGCACGTGGAGGTCCTGGAGCTCGTACCACTGGTCG
GTCGCCCGGTTCTGCACGTGCACGCGGTACGAGCCGTCGGCGAGCGGATCCATGTTGACGGCGGTCGTCGCTTGGCCAATGGTCGGCGGGCTGTCGTGGC
ACACGTTCGCGACAAGGTTGTACTTGGTCGACGGCAGCTTGGAGAGGACGCTCGTGACCAAGTGCTGGCGCTCGAGGATGCCGGCGCTCGAGCCACCGAG
CGACGCGAGGAGCGCCTTGAGCTCGCCGATCGACATGGCTGCGATCGCGTCGCTCGACATGCCGAGCTCGACGTGGTCGCTCATTTCGAGGTTCTTCACG
GGAAAGTTCACGATCGTCGGGTTCTTCTCGGTGAAAAAGTTGTTTTTCGTGAACCGGTGGATGTGGAAGATGAGGTACTGGGGCAGCGTCTCGAGCGTAT
ACTGCTTTTGCTGCCGGACCGCGCCTTGAAACACGTGCTACCGCCATGTGTCTGCACCCGATAAGAGATATCGCCGTCATACCGTGATCTTTTCGCCGTT
GAACTTTTCCAAGACCGTAAAGAGGGGCACTTGGGGAATGACATTGCCGCCCTGCGAGTCCTTGAAGAGCGGCGTCGGCGGCAAATCCAACGAGAGAAAC
CTACAGCGCATGCATAATGCCCCAGTTGCGACACTGCGATGATAGCGTGTACAGGAAGGGCGTCGTGGCCTTGGTGACGCCGGCAGCGGCGCCGTCCGAG
AGCGTCTTGACCTGCACCGTGCCCTGGAAGACGTCGTGGATGATGCTGCTGCCTTGCTTTCGCGTGCCACCGACGCCCTAGTCAGCATCAACATGATGCA
AACGGTGGTCGCATCCCTCGAACGTACGCGATGGAGCTCGTTGAGGAACCACGAGAGGAACTCGAGCGCGTCCTTTTGCTCACCAATGTGGAAGCGCTTC
TTGCTCGCGACCGAGATTTCTTGGACAATCTCATGCGGACTGATCTAGCCGGAAGCATGAGCGTCCTGCATGGGTCGCCAGGGTTCGACCGTGTTTTTGA
TGTTATGGGGACTCCACATCTTGCGCATCATCTCGCCAAAGCGCACGACGAGGCTCGATTTGGTCTTGGCGACGGCCGCCATGTAGTTGGCGGGCTCGAG
AAAGTAGTCGCGGAGCGGCGGGACGTGCGCGAGCGCATGCAGCACGACCGAGACGTAGTCGGTCTTCTTGAGGTTGTTGAGGCCGATAAAGCCCGGGAGG
TACGAGACGCCAAAGCTGTCTTGGGCGAGCTTCCGGTTCGCATCCATGTGCGCGATCTGCTCCGTCGTGAACGTTGGGCGCAGCGCGTGCTGGATCGGCA
AGAGCGAGAGGTCGTTGACCTCGTAGTTGTCGGGCAGGCAGTAGATCTTGTCGGTCGAGAGGTTGATGAAGACGTGGTGGAAGCTCTGCAGCGCATGCAT
GTAGGCGTGCGTCTTGGGGCCACGGCCCTGGAAGTACTTGCCACACACCAAGCACGCGTACGCGTTCTGCGCCGAGAGCGAGACCGAGCAGACCTTCTCA
AAGTCAAAGTCCAGCAGCTGCGGCTTGACCGTGTCTAAGTATGGGCAGCGCTTCCGCTTGTTCATGCTCGTCGCCGGCGTCTCGTCGTCGGGCTCGGGCT
CCTTGCGCTTG