Description :
From Genome Similarity Track
Location :
scaffold_137:13290- 18109
Transcript NameFunction/comments
g5751.t1hypothetical protein

Sequence
4819 bases(100 bases per row)
ACAAAGACCACCATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGATCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAGTG
ATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACACGCTGGCATACCTCGCAAGCACGAACGTACGTGCGTACCCATTTGTACTGGTGACTCCAATA
GAAGTCACGCGTGAGAAGTAAATATGTCTTCTCACGGTCAGGATGTCCCGATGTCGGGGTATCGTGATACTCGTACGTGATCTTGAGCTTCAGCTCATGA
TCATCCGGCACGACAATGGGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGGCCATTGTGTACACGGTAACGGTGTACACGAGCACGAAGGTGTT
TGGCCAGCTTCTGACGAGATTTGTCAGAAGGTGTGGAGAAGTACTCCAACAACTGCTTCGCATCCGCATCATACGCGTATGCGGCCTTCACGTCATCCAA
CAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCACG
ACATTCAACCTGGAAGTTGTATTCCGTAAAGAATGACAGCCACCGTGCCATTCTTTGGGATATGTGCGGTGATTTGATCGCCGTACGTAATGATGCGTGG
TCAGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTTCCTTGTCATGTACCGGGTAAT
TGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGCGCATCCGATCGCGAAATCGGA
TGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGCCGCCTCAGTCAAGCCCTGCTTGACGGCTTCGAAGGCCTGCTGACAA
TCAGCGGTCCATTCCCATGCAGCTTCTTTCTTCAAGAGCTGCGACAGCGGGCGAATCTCGCCCGCGTAGTTGCTCACGGACTTGCACAAGTACGTGGCGA
GTCCAAGGAACTGCCGCAGTTCCTTTACATTTGAAGGCGTAGGCCATTCATCGATCACTCTGACCTTTCCTGGGTCAGGGCGTACGCCGTTCTTCCCCAT
GAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCATAGAGCTTGTGCTTTCGCATGAGCTCGAGCAACTTGCGGAGA
TGCTCTGTATGCATCTCCACATCCGACCTCCCATTCACAGCCCGGCTGTGAATGAACACATCATCGAAATAGCTCGGTGCGAAGTCGCGCACCGAGCGCA
ACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGACCCTGCGGCATCACGAGCCACTCCCAGAGCATGCCGCTCGGAGTGCTTACCGC
TGTGAGAGGGATATCACTCTCACGCATGAGGGTCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTCGAGGTCATCGAATCGATGATC
ACATCTTTTCGAGGTATCAGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACCCGCCCTGTGGTTTCTTCACAC
AGAACGTAGGCGCGCTGCGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGATTGCCTTGACTTGCTCACGCGG
CAGTGGACACTGTCGCGTGACGCAATACTTCGTTCCCGGCACGAGATAAATCTCGTGCTGAACACCCTTGTCCTGCGGTAACTCCGCAGGAATGTCGTCC
GGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGCCCCAGCCTTGCTCGTCGAAGCGTTCCTTCTTCGACTTCGCGC
TGAGGGCGTCCGCGCCCTCAGAGATGAGATGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGATGCAGATCTGCTCGATGCGTCC
ATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATCCTACAGCCTCATCTTCTTGTAT
TGGAGACCAATACTCGTACGCGTCAAGACACTCAATGTCTCGACGGTTGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAGCGTCTCGGTTC
CTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCGACCGTGGACAG
ATGTTCCTTGTGTTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTTAAGCCCGGCTTGATCGCGCACTGCTTCGTCGTGCAGCCCGGTTGCACGCGAG
CTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCTACGCCTAACGG
CGGAGTGTCTTTCGACAAATTGTGTGTCGACATTATCTGTCGACACGACCGCGTCGCTCCGGACGCTTCGAGACCCTCTCGAATCCGATTGAATCAGGCC
CTGCGAATTCGTTTTACATCTTCTTCCAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCTCTAGTGGA
GGGCCGCATGCACCACGCGGTGCATGTGCTGCGCCGACAGGACCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGCTTCGTCC
AGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGGCGATAAGCTCGTCGACGAACTCCTT
CTCTTGATAAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACC
TCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCACCACAGTCGACTAGAGCACGAAGAGACTTCTCTCTCTTCGAGCTTA
CCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGAC
ACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGGTTTTTGATTGCCCGTGACGATACCCAGTATCGCCACGACGGCTCCTCG
CCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGTGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGGACCAGC
AGCGGTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTACCACCGGTCGTGGCATCGGCCGCGGGGCGTTCACATGCAGTTTAGCCTGC
CGCAGGCTAAACTCTTCTTGCATTGCGAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAAGGC
CTTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTCATG
CTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTCTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACGTG
CTAAAGCACGTAGGGTCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTCGA
CGATACGTCGAGCCGCAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAGCTGCTTACGTGGAGTTTCAATGA
CTCCACGCGCGGTGTGGCCGATGGCGACACCGAAGTTCGAGCAGCGGTTTCACGCTGTTCCTTCACGATGAAACCCAGAGCAACACCGTGTTGCTCCGTC
GGTGATAGCGTTCGCAACATCGTTGCTACCGCCGCTTCCCCAATGACTGTTGACAGTCGTTGGAGGGCCTCCCACTCTGGTTCCGACAGGTGGGGGCAGT
CTGCACGCGCAACATGCGTTGCAGACGTGTTTGGGCTACCCACGGACATGTTACTGTCCGAGGGCAGGTTCTCAGCCCCGCGTTCGTATTCCATACGAAC
GTGTTAGTCGGTCGTTGGACGGACTACAAAGTGCTACCAGGTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACACGTGTGCGCACGTGTAGGAGG
AAGCGTAGGAGTAATTTACTTAAGTTCAGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAATGAACCGAACGAAGCTTTGGTGGTAAATGAGAA
CTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAACCCCTATCTATTGAATGACTC
TCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTGAATGTATGCCTTAGTGCATGT
TGCACTAAGGTAGGAGGTG