Description :
From Genome Similarity Track
Location :
Scaffold_39:132886- 134541
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G012023Protein of unknown function

Sequence
1655 bases(100 bases per row)
AGCCCAGGAGCACGCGATAGTCCTCATTCGGGTAGCAGAACGCCGCACTCGGTAGCCCGGCCTGGAATTCCTATGTAAGGCAACAACAAAGCCAAGTTAG
CGGAGTTGGTATATCGCGGCTTGTGATATTGTGTTTGCGTACTGCGGTGGAGATGTGAGTTGGGCGGATGGCCATAAATAAATTACTAAGACAGCCGCGC
ACGATATGGCTGTTGCTGTGTGCCGCCACTAAAGCCGCAATCAACAGCACGGCACATAAAAGTTAGCACTGATTCATTTCGCATGCTCACTGAATAATTC
GCATTCGACTCACTTGTACTGAAGAGCCATGCGCCAATCTTCGCCGGGAGCACTGGTCCATTGGCGTCACTCGTCTTTGCGTCCTTGGTCAAGACGCAGC
GCAGAAGAATCGCTTTGCTCCAGAGCAACGCGCCGATCTCGTTCACGTCACTCGACTCCATAGCTTTGTACACGAGCTTCAATTCGCTGCTGAGCTCCGC
GGGTGTGGCCTCGTATCGACGGTACGGGAGCGGCTCCGTGATCGGCGAGAAGACGTAGCCGAAACGCTCCTGATTCTTCGAGAGCTCGTCCGTGAAGAGG
TGGTTGTCGGCCGAGAGACTCGTCATGTTGCTCTCCATGGCGTTCATGAGCTTGCCGAGCGGCGACGCGCCGTCAAACGCCGGGTTCTGCAGCGACGTGT
CGCATTCGTCGCGCAGCTTCTGCAGCTTGCGCTCGCGCGCCTGCTTCTTGCGCTTCTCCTCCAGGTCGTTGTCCAGTAGCGCGTCCAGACTCATAAACTC
GTCCAGAATCGCGGTCTTGGCCGGAGCGCCGCGCTTGCGTTTCCTATAGCGTGTGTAGGGAGGTGCATATACATACATGTGAGCTCCACATATCATGAAA
GCTATTCACTAAACAGCAAAAACATATAGCACAAGCAAGGTAGAAAAAGCACGCAAACGTACGAGTTGACACGTCGCTTGTCGTCGTCCACCTTCGCCAA
GAGTGCTTCGGCATCAGCATCGCCACCGTCTGAGTCGCTATGCCTGTACACACAAAGCACAAGAAATGAGCACTTGTTTTCCATAGTAAGCGCCATGGTG
GCACAACACCACCACGAGAGCATTACGCTGCGGCCTTCTTCTTGTTGGCGGTTTTCTTGGTGGCACTGGCGCTTGCGCGCGTGGACGTTGCCGCCGCACT
GGCGCTACCGCCAGTGGCCGTCGTGCTACTGCTGCTGATGCTCGTGCCCGCCTTGTTGATCGCGCGCGGCGCGCGACGCGGCTTGTCCGTCGCGGTCGTG
GCCATTTTCAAATTCCTAATTGTGTGTGTTGTGATGGACGGGCAATGGAAGCGGGTTCGCGGGTCTAAGTGGGATCCGGGTTTTGTAACCAACCCGGCTC
GCAGATGAAGAGTACCGTATACAGTTTTCTTATATGTCACAATTGGGTATGACCCACTCCCAAAGTGGGTCATACCCAAATGGCCCTGCAGGTCACGAAC
GGAGTTGGTTACAATTGTTGCAGCAGTCCCCTCTTTTATGCGCACGTATCCAAGCGAGCTGTGGTTTTCGTTGTTCGTTGAGTTGCTCCCTACAGCAACA
GCGAACACCTGGCAGCAGCATGTTTCTTTCCACGAAGCGCGTTTTCTATTTTTTT