Description :
From Genome Similarity Track
Location :
Scaffold_28:132839- 134166
Sequence
1327 bases(100 bases per row)
gttttgcgtccgcgaaggcctctgtgtcgtcagacatcggatcggacaaccccgccgggccaacgagaatgacccttggtccatcgggagccgctatgct
ccaggcgaggaagatcaaggaagagaagatgcccgtgaaccctgtgcccgtagccagagcaacgacgaacgcccacaacccggaccgcatgcaatcgttc
ttcgactcggccatggaacgtttcttgaaggagcaagccgaagagaagaaccgcagcgagcctagagcacgtgaggcgtccgatgtcgacatggaatcgg
tgggatcggtccacgcatctccggatgagtatgatcccgacgacttcagcattgacgttccccgccgagcaatcgttgcctcagcagaagcaaccgcgtc
tgccgaacatactgctgcggtcccgcgagtccggatgtcagcaatctccgagctgaaggagttctccggcaaagacactgacgaggatcgcgcccgcggc
tggctgggcaaggtgaagtctgcgttcgtccgtgatcaagctcctgatagcgagaagtgtatcgtcttcgggaacttgctaactggtccggcgcggaact
ggtaccagcagttgggaagaacgacgcgtggcaagtggaaagacctgctggatggcttcagggccgaatactgcggtctgggcgtgtctctcgcgagaca
atattaccacgcgaggaagagatctgatgagtcgccactcgaatatctccaccgcctgaccgtgctcggactccgtgcgaagttaccaatcaagacgggt
ccgtcgtctgccctccgagaacacgtggaacacttcatcgaaaccttggacgatcgcgatctagcggaccagctgacgctactgcgcctcggagatgggg
acgcactggcagacgtattacgcctacgccagcgtgccaaatcccggcaaggaaaggcgtccatgggatcttcgaagtaccgccagaagtcgtcatcgtc
aacacctccacaagcgtccaccaaacatgcccgagcgattcgcgccattcacatggcccatgacagcgagagctcgggatcggactcggactccggagga
tcggaccttgaacgaagcagatcccagatctatctcgctgccgtcgttgatcagcgtaagtcggaagatcagcctcagccacgccgtgacgctcaaggac
cagcaaacaacccggagcaacctcatcgccctcggaacgacgatcgcgtagagagatgttcccactgcgggtccacgcggcacacggaccttggatgctg
gaagcgcttgacttgtcagaagtgcgg