Description :
From Genome Similarity Track
Location :
Scaffold_24:1328019- 1332621
Sequence
4602 bases(100 bases per row)
CTTGCAGCAGCAGCTTGAGTCGTCGGGGTTTCAATGAGCACTCGAGCGGACGCAGCAGCTTGAGTCGTCGGGGTTTCAATGAGCACTCGAGCGGACGCAG
CAGCAAGCTTTTTCGGTGGGGGAAGCGGTAATTTCAGCTCAAGCATTCCCTCAGTCCGAGCAAACATCATAAGCTCGTTTTCTCCTACGCCAAATCAAGT
TATTTAGTCTATGAAGGACTTTAGATAGCAATTGAGCGCTAACTTACCAACAAAGTGGTCAACGCGGCGCTGTGCTGCAACTAAGCTGCGAGCGACACCA
GGCTTCACATAGGTAAAGTCCACACTTAACCCCTTCGGTTTTCTCGACTTCCATCCCTGCTTGGAAAGCTCGCGCCATAGCTGCTTGAATGTTTTTTCGT
ACGGGCCGTTCATTATGGGGAGAACGGATTGTGCGGGACGAGAGTAATGTGTGGTGGTCTGTGAATCAAAACGGCTCATTACAGAATTTATAAACCTCCA
TGGATTTTATATTGTCTTTTCTATGATGCCAGTGAAATCCCCGTCTATCTTCGCTGCGAAGATCTTCAATGATAAAGTCGCATACAAAAAGATAGCATGC
GGTGAATTAGGCTGATGGTAAGCTCGTTTGATATAAGAACCTGTCCTACAGCTTATTCTGTATGATACAGAATATCGTCTTAGAAGGGTTAAAGCGGTAG
TCAGCTCTTCTACGGTCCTTTAGGGGCTTATTCCATGCTATGTCTGCTGGTTGACAGCAGTGCGTATATCCAGGGGGAATGCGTTGCAGAACGACATTTT
TCTCAAGAGCAAATGCAACGACTTCAGGCGTCCAATGCGCATTGAAGTCGTCCCACATCAGCATCACAGGCTCATTAGCTGAGCTCTGTTCACCAAAAAC
AATGCTGCAAGAATTGCAGGTCACAAGGACCGAATCACGACGCGCATGGTGCGCGTTTCAAACAGGTAAAGTGCGGCAGCTTTAAATGCAAAGGTCTCCG
ACATCAGCTTAAACTGCTTCTGCTTCCGCCCGCCTCGTTGCCACGGCACCCGCATTTTGGTCCTTAGTCTCTTCGCTGCTCTGCGGTAGTTCCAGTTATG
CCGCACTGCCTTCAAGGGGGGGGGGCACTTGACAAAAACACTGCAAATTCTACTTGGCCAAGGTCCAATTCACGGCTGTGATTGGTCAATATAGGAGGTG
ACACTTGACACCGATACTACGGTACAGCCCCGGTAAGTTCGCGCCACGTAAAATCCAGTATACTGTTTAAGTACGCACATCTGCCTCTCAATGGGTTTCA
CATGTACTGCAAGAAGCTGAGCGAACTTACATCTGAGAAACGTCAAATAGCGGCAAATTGGCTACGATAAAAACAGGAGTCAGATTTAGCTCCGGTTTTT
CAGCGACAACGCATGGATAGAGCTACAGCTGCCGGAATGTGTAGGTTTACTCCTCTCATGGAAGGTGCCTACTCTGTTCAACACCTTGGTCCTCAAAATC
AACACGGGTATATTCACGCTTGATAACTTGTTACTCTTTCAGCTCGAGAATGCACATGCGGGAACTGGCAAGATGAAATGTTTCCGTGTATTCACGCTAA
TTGTGCAGCGATTCAGGAGGGTCCCCAACTCGTCTTATCATGCTTTAGACAAAATAAGATTGACATCTGGAGATGTAAAGCCCCATTTTGGTTTTATCGA
GATGCCGCCGCACAACAAGCGCAAAAAACACGTTAGGAACTTCAATCGAAAGGCAGACGGATCCTTCTACATCTTAAGATTTACAAAACCCTACGAAGAG
CTCTACGATGCAGAACACCTCTACGCCAAGCGCTGTGTCATTAATTTAGCGTTTTTTCTGGTGCAATGCTTTGGGGATCGCATATTAGCGTGGGAGCGGG
CCAACACCACCTCCCACCCCCGTTGCTGTGAGGGACCTGTAAAAAAACTCATGCAATTGGTGGGGTTTACCCAAAACGACAGAAACTGGGAGCGGTTAAT
AACCGGCGGGATGCGAAAGGGGGGGACGAGGGTATAGAAGAGAGGCGAAAGGAGAGAGGGAAAAAAAAAAAGAGAGGGACTCGAGCCCACAAAAGCGCGG
GAGATGAGTCGCCACAAGATGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCATTGTTAAAAAGTCCATCGGGGGCAGCAGTCCAGAATGGCTGGCGACCGTCTGGCAAGATGTCACGACGGACGCTG
ACAGCGGAAGAGACACGATTGTGCAAGACAGCCCTCAGTGACCGCCACAAGCGTCGCCTTCGTCGAGACGACGAGAGGCAGTCAGCAGCAGAGCCAACGC
ATGACGCTGAGGTGCGTGTGTTGAAGAAGCAGTCTAGGAAGAGGGCGATGATACTTACGACGACAGCCATGGAGATAGCAGAGTCTAGAGGTCCACATAT
TGAGCCGGCAGCACCCAAAGAGACAGAAGCAACAGCGAGTACGGACGAAGCTAAAGAGGTAATACCTGTTGCAGAAAATGAGGAAGATTCTGTGGAACCA
GAGGTGGAGGAAGTTGTAGCAGACGTGGTGATGGCTGTGGCTTCAGCTGTGGCTTCAAGTGCGCTTCTAACGCCTGTGCGAGATGCTCAAGGCGCTGTGG
AGACCTTGCGCCCCCCTCGGACGAACAAGCAGGCGCCGGTTACGCAAAGATCCCCGAAACGACGCCGCCGCGTCCTACAAGACAGTCCAGAACGCGAAGC
TCAAGCTGAAGGCACCATAAGTGACACCACAGACACCGGTGCTGCGTCAGCTGCCCCGCATCTCCCTGTCGCCTGCGTAGTTGACGGTGATCCTAACATC
ATGGCGGCTGGTGCACGTGAGTGCACTGGCCTCGGATCAGAAGAGGAATCTGGTCCTGATTCAGACGATGACCAACGCGAACGGTGAGTGAAAAGAGATT
GGGAAGCTGGAGAATCTCTTAATGAGAGTTAGCCGATTGCGTTGGAACTGAGCTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNGGCGGATAGGTACTTCAAAGGAATTGGACAGGGAGATGACAAGGTAGTGCTACGGCTCATCGTTAGCGGGAAGTCAGCGTTGGCTCCCCCTCGAGAC
ACAGCCCGTCCAAGTCCCGAAGAGCGCGGTCTCAGCATCCGACGGAGTCAACGAGCACATAATGCACCAACACGTGTGGTCACTGCCCGCTTCCCGTCGC
TGGTATGACGTGATCTACATCAGGCGGTGTGCAGTGATGCACGGCTCGATCAGAGAGGATCTGTCTGATTCGAGAGAGACGCGGACATGATGGGAAGAGA
TTGGGAGCTTGGAGAACTCTCTGATGAGGATTAGCCGATTGCGTTGGAATGAGCTACCGGACAGTTCTGCAATCGGTGGCGATGATGCGGCGGTTTGGCG
GAGATGAAACATTCTGGCTGGGAGTAGGTAAATTATGTGGAACGCTTTCCAACATACGCAACTATTATTCGGTCGTTGTCCAACATAATGTTAACATTAT
CTAACTCACTTTGATGTGCTATTTGTAGACCAGTCCAAATTTGGAGACAATCCTACGTATGAAGACCTTTACGACGGGCCTTATGGACCATCTGAGAGCG
TCCTTGGAGTGGCTGAAGACCCACTGGCGCTGTTCTTCTACTACCTACCGCCAAAATTGTGGAGACAGATTGCCGTCGAGAGCAATCGCTACCACACGCA
GTCGATACCGGGTCGTGCGCAGGCGATTCAAGCGAAGCAGCGTCGTGGTGGTGCAGAAGTAGAGAACCTCGCAGATATTCGTCGGCGACTAGCACGTGTG
AAGCCGATAGAACCGTGGGAGGTTTTGCGCGTCATCGCGCTTCTCATTGCAAGGATGCTGTCTCCAGTGCGAAAGGGGATTGCTGCTCACTGGGAGTTGA
CACCGGCTGGTGCGTTGCCAACGCCACGCTTCGGCAAGTACATGTCCCGCAACCGGTTCTTCCACATAATGGGATACTTGCACTTCTCCAACAACAAGTC
GCCTCAAGCTAGCACGGATCGTGTATGGAAGATTCGGCCGGTTATCGAGGTTTTACAGCGTACATTTGCGCGCGGCTACAAGATTCCTCCTGTCATTAGC
TTTGACGAAGCTACGCTGCCTTCAAGATCCCGCTACAATCCTACCAGACAGTTCAACAAGGACAAACCGCACAAGTGGGGGACCAAGGTGTTCGTGGCAG
CG