Description :
From Genome Similarity Track
Location :
Scaffold_160:1328- 2579
Sequence
1251 bases(100 bases per row)
CCAGCTCAGCGGACGGCGGCCGTTGTATGGAGCGAAGATGAGGATCATAAGGGCGGATAAGACCACCTGGATCGAGCCCGGGGAAACCTGGGAGCTGCCA
GATCGGTTAAAGTGGGTGGAACATGAGAAACTGTGGGTCACTCGGGGCGAGAAATGGGTGCCTACCGTAATCCAGGGACCAGGTCGATCGCAATACCTCC
AGGTCACGAACGTCAGCGAAAAGAGACTATTACTGGACCATTATGAAGAGATCGGACGATGGTTGACGAAGGACGGTATCCCTAGGCGACCTGGATATGT
GTCAGTGGGATCCCGTCGTTACAGAGAATGGCAGAATCTGGCGTACGAGGCGACTACCGAAATCGAATCTGTCGGAGAGGTGGAGCTCCCGGCGGAGCCA
ACTGGCCCCTTGGTGGATCGGCCTTCATATCCAACTCCGCGAAAGATCCTGCAGAGGGATCGACGGGTTGAGATCCAAGCAATGAAGGTTGGATCCACGA
CGGGGGACGATCCCCAGAGTCGGCCCTTAGATAACGCAGGGTCGGTGGATGAAGGATTGCAGAGGGCTAAAGCCGAACAGCCGGATCCCGCTGATCCACA
AGTGGATCCAAGCTTTCCATTGGATAAAGTGCCTGGATCCCTATCGAGAGTGGCAACACTAGTCAAACCAGAACCGTCGGGTTTAAACTCGTTAGAGGAC
CGACTAGATCCAACTGGTGGTTTCCCGGATACCAGGGTACCTGATCCCCCGAAGACAGAAGGACTGCCAGGCGAAAGAGGGTCGCGGTGTTTGGATCCAA
TGGTGGATCCTACGAAGACGGAAGATGAGCAAGTCTGTTACCATGAAGGCGGGGATCTACACGCCGAGGATGTGGGAGAAGGCATGGCGCTGATCCCGGA
GGTACCACTGACCACAGAGGAGGTCACGATTGATGGGATCCAGGGACGAATGAACCTGCTGAAGTGGACCGTCTGCGTCAGAAAATCTGGGAGAGCCAAC
ATCGGCTGATTGGTAAAGGTAATGCGTTACCGCCCGCTGCCCGCGGAGTCAAATGTGACATCGATGTCGGCGACGCGAAACCGATCGCTCAGAGGGTGCG
GAAGGTGGCGCCTCAGTTCCGAGAAAAACTATCGGATCTGATTAAGGGCCTGCTGCAAGCCAAGATCATCAGTTTCTCAACGTCCCCGTGGGCATCCCCA
GTGGTAATCATCATCAAGAAGAACGGGGTGGATATACGTCTGTGCATTGAT