Description :
From Genome Similarity Track
Location :
Scaffold_415:13271- 15027
Transcript NameFunction/comments
Phyag_g5512hypothetical protein
Phyag_g5513hypothetical protein

Sequence
1756 bases(100 bases per row)
TagcgccttcttgacgacggCGTGGTCGGTTTCACCAGTCTCCAGCCACCACCGTACAAGAATGTTATTCCATAAACCTCTCTCTGCGGAGTCTTCGTCC
TTTGCTTCGTTGTTTCCCCCGGTCCTCAGCGATCGCCCCTGGACTTCGATGTTCGAATAGCTCAGCAGAGAAGATTCAGGCGCAGCCAGTTTGTCCGATA
CCTTGGGAATTCCAGTCTCCGtagcattgctgctggagaggagaGCGACAAACGTTACAACCAGTACTTGGTGCAGGAGCATGGCTGAGCTTGGAGGGGG
AACAGCCACAGAAATTCTTACGTGGTGAATTGAGAACTGACTTATCCGCCTAACTACTACAGGCTCAACTCCCACAAATGATTATCACGGGAGCCGTGTC
ATCAAATATCATTTATTATTCCAGGCAAAAATATCATTTGATAGAAAATAAGTGGTCCACATAATAGCATAGCCAGTCCAAACAGCTTCCATTCAGAGAA
CGACTACCATGCCGACGAAGCCTCGTGTTCTCCGCACAGGCAACCTCACCGAAGGGGAGAAGCTACAGGTCTATGACAAGCACAAGCGAGAGCCAAAGTT
GACGCAGAAGGCGCTAGCGGAGTGGTGTCGCGTCAACTTTGGACTAGAGAAGGCCCCAGTTCAAGCTACAATATCAAATATACTGCGACGCTTCAGTAAA
TCACCAGCCATCACTATTGCTCCCGATCGGAAGACGTACCGGACTGTCACGTATCCGGAACTAGATGAGGCTCTCGCCCTCTGNGGAAGACGAACCGGAC
TGTCACGTATCCGGAACTAGATGAGGCTCTCGCCCTCTGGGTCAACGATAAGCAGGCCAACAATGTACCCATATCGGACGAGCTCATCCAAACAAAGGCA
CGGCAACTGTTCGAGGCGCTGAAAGAGCGTGGCGTGACGGGGAAAGAGATTACATTTTCTGCTGGATGGCTCACTGCATTTAAAGGGCGTCATGACTTCA
AACGAGTGCGGCTACATGGGGAAGGTGCTAGTGCAAACAGTGAAGCTGTTGTTGATTTTTTTACTCGCATTCAGCCTAAACTTGACACTTATTCGGCTGC
AGACATTTTTAACTTCGATGAAACTGGACTATTCTACCGACGTAGGCCTACGACTACGATTGGAAAAGGgcatgctgctcttcgaggaagcaagaaggac
aagactCGGCTTACTGTTGGATTGGCTGTCAATATGGATGGATCGTGCCAACTTGAACCATTGTTTATCGGTCACGCAAAAAAGCCCCGCGCATTCAAAA
AAAAATTACCAGTCGAGCTTGGTTTCTCACATTATTATTTCAACAAAAGCGCATGGATGACAACAGTTATTTTTCGTCGATGGTTGGAAAAAGTTAACAC
AAGCATGCTCCGCCAAGACAGAAAAATCTTACTCTTGATTGACAATGCTACGTCTCATCTAGATGTGGAGCTCTCGCACATTGAAATCGTTTTTCTGCCC
CCTAACGCTACAGCCATCCTTCAGCCGTTGGACGGTGGCATAATTGGATGTTTTAAAGCTCACTATCGGCGTCTGCAATTCATGCAcgcagttgctgccg
ctgacaGACACGAAGAAGATTGGTTTAAAGTGGATATTTTGACGGCGATGAGATGGGTAAAGTTGGCGTGGAATGAGGTGTCAACTGAAACGATTGTGAA
TTGCTGGAGAAAGAGTGGCTTTTCCTGTGATTTTTCAACATCCACTAGAGTGTATC