Description :
From Genome Similarity Track
Location :
Scaffold_117:132703- 138190
Sequence
5487 bases(100 bases per row)
TACCCCTTGAGTCGCCCGACGTAAAACGTCGGGTGGAGTCTAAGTGACGACGGAATGTCCAGAGTGTAGGCGTCGTCCAGAGTGTAGGCGTCGTCCACAG
CCTTGGTTACTCGAAAAGGACCGATGAAGCGTGGAGCAAGTTTGCTAGCTCCAAGGTTGGTTACGGCAGAAGCTCGGATTCCCTCGGTCGATAGGAGAAC
GCGATCTCCTATCTTGAATACATTCACGTTCTTTCGACCGTGCTTTTCAGCTTGTTCCTTTTGCTTGTCCACTGCATTCTGCAGTGCGTCGCGGACGAAC
CTTGAGATGGATTGCCTTCGAATGACGAATTCCGCAACTGCCGAGCGATCGGCAGGGAGCACCGAGATTTTCGGTGTATAATTGGTCGTGGTAACTGCCG
TCTCGCGAATCTTGCTGTCTGGATCGATCAAGTTCTGCGACGTCCATCTCGTTATCGGAGATGCAGTACGCCGAGGAGGCTCGATGGACTGCTTGGACGG
AGAGCAAGTCAAGGCGTTCACACTGGCTACACCCGAAGATAATCCTGAAGTCGAGTGCGCCGGCAGGCCTGTTGGCACCGGTGAGGCTACCGGTGCGTGA
TGAGACACCGGTTCACGTACCGGTGATGACCACAACACGGACGCGTTGTCCGCAGGACTGACCGCAAGTTCAGCGTCCATGTCGACCGAAGGAGGTTCTC
CCCCACCAAGGGTGGAGCAGCCAGCATCCGTGGGGTGACCCACGGCGAGAAGTGCCGGAACACCTGGGTGGCGAGCGTTGTTCACGAAGAACGGCGTCAT
ACCCGTCGAGGAGTGCTCGGCGTTGTTGAGTGCGAACTCGGCTAGCGGTAGGAAGAGCTCCACCTCGTGTACGAAGTTGCATAGCTGCGGAGAACGTCTT
CAAGGACGCGGTTGACGCGTTCTGTTTGTCCATCCGTCTCCGGGTGTGCCGCAGTCGACATCAGCAATTTGGTTCCCAAGAGCTCGAAGAGACATGACCA
GAACGCGGATGTAAACCGCGGGTCGCGGTCGGACACGATGGACTCCGGCAGACCGTGGTGACGAAACATCACGTCGACGAAGTGGGCCGCGGACTCTTCT
GCGGTGATTAAGGCTGCCACCGGAACGAGATGGACCATCTTGCTGAAACGATCGACGAACACAAGTACAGCCGTGCGCTCGGCTGTATCGGGCGGAAGAC
CGAAGATGAAGTCCATCGAAATGGAGCGCCAGGCTTCCGTGGCGACCGGAAGAGGGCGCAATGGGGCCTGAGACGTCGAAGACGGTTTGACTCGCTGGCA
AGTTTCACATGTGCGAACACACTTGCGTACCCACTTGTACATGTGCGGCCAATAGAAGTCTCTCGACAGAGCCGCGTACGTCTTCTCGCGACCGAGATGT
CCAGTCGGGGCGTCATAATACTCTTGGATTATGCGCGCACGTAGATCAGCGTCGTTTGGGACGACGACTCGAGGTCCATCGAACCTGTCGATGCTGTACT
TGAGCAGATTGCCGTCCAGTCGATATCGATCGATCTGATTCCGCGTGGACTTTGACAGGGCACTTAGCGTGTCACTACTAGGAGCACGCAGGTGCTTCAT
GATGGCACCGTATATAGGGTCATCATCGTACGCTGTGACAATCTCGTCGACCAGCGGGAGCGTGGGCGTGGTCAACGTCAAGTTGATACCTGACGACACG
CAGACCGCACATTCGTCGTCGTCCTCATCAGTCAGCTGATGTCCTAGCGCTTCACGGGGATCGTAGTCCGGACGCCGAGACAGCGCGTCGGCGAGAATTA
TATTATTGCCAGGCTTGTAGTGAACAACGAAGTTGTACTCGGAGAAGAAGGACAGCCAACGAGCCATCCGTTGCGACAAGTGAGGGCTCTTCATCGCTGT
CCGCAGCGGTTCGTGATCAGTGTAAACCGCGAACGACTGTTCACCGAGCAAGTACACTCTGAATTTGATCAGAGCGTACCGCATTGCCAGGAGCTCCTTG
TCGTGGACTGGGTAATTCTTCTCGGCTGGCTTCAGTTGTCGCGACTGATAGCTGATAACGCGCTCGTGTTCGTCATCATCGAACTGCATCAGCGCACAGC
CGATGGCAAAATCGCTCGCGTCGCAGACGACGTGGAATGGCTTTGAGTCATCAGCAAGCTTCAGGGTCGGTGCAGACGCCAGGCTCTTCATCACCGAGTC
GAATGCAGCTTGGTGGTCCGAATTTCACTCCCAGATCACGTCTTTCTTCAGTAGCGAGGACAGCGGCTGGACCAACCCAGCGTAATTTCTTCGTGTACTT
GTGCAAGTAATTGGCCATGCCAAGCCACTGACGCAACTCAGTGGGGCTTGTCGGCGTTGGCCAAGCACAGATAGATGATACCTTCTCGGGATCCGCGCGC
ACACCGGTCTTGCTCACGTAGCATCCCAACACCGGAATCTCCGGTGCGCAGAAGATACATTTCTTCAGGTTTGCGTAGAGCTTGTTCTCTCGCATCACCT
GGAAGACTTGTCTCAGGTGTTTCAGATGTACTTCCACGGAACTGAGGTTGCCCTCAGCGCGGCTGTGCATGAAGATGTCGTCGAAGTAACTCGGCGAGAA
GTCTCGAAGCGGGCGAAGCACATGGGAGACCATGCGATTGAAGGTGGCAGGCGCGTTCTTGAGACCCTGTGGCATCACGAGCCACTCCCAGACCATCCCG
CTCGGTGTACTTACGGCAATGAGAGGCACATCACATGCTCTCATCAGGATCTGATAGAATCCATAGGTCAGGTCGATGGCGCTGTAGATGACGCTGCCAG
CCATGGAGTCCAGTACCATGTCCTTCCGAGGGATCGGAGTCTGCGCGGGGATAATAGCATCATTCAACTTTTTGAATGCGTGAACAATACGCCATCCCCC
TGTAGCTTTCTTCACACAGAACGTTGGACTGGAATGAAGAGAGGTACTCTCACGCACGTGACCCGCCTTTCGGCGGCCCTCGAAGAAGTCATCGATCGCT
TTCACTTGATCACGAGGAAGTGGCCATTGTCTGGTGACGCAGTACTTCGTACCTGGCGCGAGGTCGATCTCGTGCTGAACCCCACGATCCGCCGGTAGCT
CGGCGGGGATCTCATCCGGAAAGACGTCGGCGTACTCGCAGGCGGTGTCGTATACGGGATTCGCTGACACCCGCAAGGCCTCCCAAGACTGCGTTTGGAA
TCGTTCCTCTCGAGCAGACTTAGATTCAGCACCTAGCGGACGTGAACGTTCACTGTCCGTTGCGGCCGCATTTGCTGACTCATCCACCGAGACTTCCTCG
GTGACCAAGCATATTTGCTCGACGTCTCCAGCCTTGAGGTCCCGAAGAAAGTCCTCCAGGACAGGCCTGGAAAGCGTGTGATCGCCGCCGCTTCGCGCGG
CGGACTCGCGATTGCGATAGTGCGCGACCGATTCGGGTTTCCTTCCACGTACTCCGGCGCGCTGACCGATTCCATCGGTGGGCTATCGCTGGTCGTGGAG
TCTCCACGAATTTTCAGGCATCGTCTCTTCGACTTCTTCTTCGACTTCCTCGAGCTTACGCTCGAGTCTGATTCACTGCTACTCGACGATGCATCACCCT
CCTCTAGGCGCGGGAGACCGTACTCGACCGGGCCGGGAACACGCGGGAGCCCCTGCTCAACCGCGGCATCGTTTGACGGGAGTCCAATCTGCTCGACCGC
CGAATCGTTCGGTGGGAGCCTCTGCTCGACCGCCGTTGTGTTGTGTGGGAGCCCCTGCTCGACCACTTCATCATCTACCTCGCGAAACCGCGCTTCGTCC
AACAACGTAGCACAAGCCATGCAAAGAGGACCATCGCTCGCTCTGTGCAATGCCTGTATCGTTGCTGTTTTGTCCACGACTGTGACTTGGGGCCAGTCTC
TTGGCGCCACCAAGAGGTGTGTGAAGACCTCGCTTACGTCGAATCCACGTCGACGCTTGACTGATTGGGCCAGCCAGTCAATCTCTGGCTGATATCGCGC
AAGCCAAGGGATGCCCAGGATGCAGTCAAACGCGTAGTTCATCTCGATCACCAAGAAGTCGTCCTTGCTACGGAAGCCGTCGAACGTGTACGACAAGGAC
ACGTCACGCCGCGCAACGCGGCGAGCCTTACCATCGGCGAGTTTGACCTGAATCTCACCCGGACCATTCCGGACGCGGACGTTCTTGGGTAGTACCGACA
AACACGACGCGCGAATAGAGTTGTTGGTCGCTCCTGAGTCAAGGAGCGCGCGCAGTGGTCGCCGGGCACCGGTGACGTGGAGGCTGACGATGATCAGTCT
CGAGTCGCCCGGCGTAGTGGTAGCATTGGTGTGTGCTTGGGGCACGGGAGGGTCGAAGGTTGGGCTGCCACCGGAGGGCCCGGTTCTTCGTCAAAGCCAG
TAGGGCGCCCCGCACCTACTGGTCCTGGTCGTTTTTTGAATGAGCGACCGAGGAATGTTCCGCATCGGCGTGAGCGACGACGGGAGCTGGCGCGCGGCAC
TCTGCCGCGCGATGACCTTTCTTCCCACAGCGGAAGCAAATGAGGAAACCACTGCTTCGTCCAGCGCTACCGCGGTGGGACCCGCGACGTCGATCGCTCG
ACGCGTTGATGGCGTCGATCTCCATGGGCTCGGGGGTAGACTCTCGGGCTTCCGCAGGTATGGCTGCGGCGTACGATGCAGCGACCATGTAATCCTCGCG
AATGGCGAGTGCAAATGCCTGCTCGAGAGAGGAGGGCTCAGCTCTGGTGAGGCAGTAGCGGGTCATGCCCTCGCGCATGCCGAACACAAATACGTGGACT
TGCGAGACCATGTCGATTGGCTTGGTCACGATGCATGACGCCAGATGTCGCGTCTTCTGGACGTAATCATGCATGGACGTCTGCCCTTGCCGAAGAGCGA
AGAACTCTGCGCGAACGCGAGACTCATCTTGCGGGGGCTCGAACGCGAGGCGCAAGTCGCTCTGGAGAGCTTCCAGAGTCGGGAAAGCCTCGGGGTCGAC
AACAAGCTTCCCAAGGGCCCATTCTTTGGCCTTCCCGGTTAACCGGGAGAGGAGGAAGTTCATCTTGGCGGATGACGCTTCGATGCGTCGCGTCGCGAGG
CGATAGCGATAGCGATGTCGATCTCGCGGAACCACCGGTTTAGCGGGAGCCGGTTTTCACCGGCGCCAGAATACGTAGACGTCTCCATCTTGACGACGTC
ATTCTGGGATGAACGCGAGGGAGTTGACACCCGCCGATTCGCATTGGCGAGCTCGCGTTCCATAAACCCTTGTGCTGCAAGACGTTGCTGGTCGGGCGTC
GCTGAGCTCAGCAGAGATGCGACAACGGCATCTCCGGACACCGCCACGAGGCAGTGAAGCGCTTCCCACTCCACGCGAGTGAGATGGGGGAATGCAGCAT
GCTCCAAAGTTGCCCCGGAGATCTGGACTTGGCTCATCGTAGACTTGGTCGTTGGAAGGACTACGAAGTGCTACCAGGTGTAACGGG