Description :
From Genome Similarity Track
Location :
Scaffold_677:1327- 2970
Transcript NameFunction/comments
g12840.t1hypothetical protein

Sequence
1643 bases(100 bases per row)
CGTTCATGGAGAACATCCTGCGCCGCAAGCCGCTCAATGTCATCCACGCCGAGGAGTCGGCGGAGCAGCTACCTCGCCACTTGTCACTCTTCGACTTGCT
GTGCATAGGTATCGGAAGCACCGTGGGCAGCGGCATCTTCTCCACTGCGGGCGAGATCATCTCCAGCACGGCGGGTCCTGCGGCGTTCCTCAGCTGGATC
ATCGCCGGTGTCGTGTGTTGCCTCAACGCGCTCGCCTTCATGGAGCTGGTGACGCGTATCCCGTCCTCGGGCAGTACGTACGCCTACTCGTTCCATGCAC
TCGGCGAGCTGCCGGCCGTGGTGGCCGCGTGGCTGCTCACACTCGAGTACGGTATCTCTGGCTCCGGTGTGGCCCGTAGTTGGGCTACCAAGGTGCAGGA
GTGGCTCGTGGAGGAGCACCCGGAGCACACGTACCAGTGGCTGAATGAGGACTACACGAACCTGCTGGGAGCTGTGCTGATGGCGCTCTGTGTGGGGGTT
CTCCTGGTGGGATTGCGCTTCGGCAAGTGGTTTGTCAACACCATCACCACCATCAAGGTGTTCATCGTGCTGTTCATCATCATTGTTGGCTTCTGCTTCA
CGGACTCGAGCAACCTCTCGCCCTTCGTCCCGCCTCGACAGGACGTGGACGGCACCATGGCCTTCGGCACCCAAGGAATCATCTCCGGCGCGTCGTCGGC
CTTCTTCGGATACGCCGGCTTTGACGAGGTGTGCTGTCTGGCTGCGGAGGCAAGGGACCCCAAGAGGATCATGCCGCTTGCTGTCATCGGCGTCGTGACT
GGCACCATGTTCCTCTCCGCCTTTGCATCGCTCGCGCTCTCGGGCATGATCCCGTATCTGGAGGCCCAAAGCTTCGGGTCTGGCTTTGACTACCAGGGCC
AGAACTGGGCGGCGCAGATCGTGCGCGCCGGTGAGACCTGCACGATGCCCGTGGTGGTTCTCGTGTGCTTCCTTGCCCAGCCGCGGCTGAACTACGCGCT
GTCGTGTGATGGTCTGATGCCGCGCATCTTCTCCAAGGTGGACAAGAACGGCAACTTGTTCGAGAACACGCTGATCTCCGGCGCTTTCTTCACGGTGGTG
GCCTTCGTGGTGCCGTTCGACACGCTCTGGGATATTGTGAGCTTCGGTATGCTGCTCTCCTTCAACATGTCAATGGCGTCGCTGCTGATGGTGCGGATGC
GCAAGGACTCGCCTAAACTGGCGCCCAGACTCGTTTGTACCATGGTTGCGTCGGCTTGTCTGGCGGCCTTCTTGTACCAGATCGGCTACTCCAACGAGGG
CCACGTTTGGTGTCTTGTGTTGAGCATTCTCTTCCTGGTGATCACCGTGGCCGTGTGCTTCGTGATGTACTTCAAGTGTCCGCAGGAGGCACAAAACGGC
GAGAACTTCGCGGCGCCGTTCGTGCCGTTCCTCCCCACCATCGCCGTGCTCGCCAACTTCTACCTGTCCGCTCAGCTGAGCTACACGGGTATCTACACAA
GCTTCGGGTGGATGGCTGCCAGTGTAATCTTCTACTTCGGCTACGGCTACAAGCACTCCGCTGGCAGGACCGGCTGGAGTGCACTGATGAGTCTGCCGCG
CGAGTCTTCGCTGCGCTCGCCCATGATTTCGGTCGACAAGAAG