Description :
From Genome Similarity Track
Location :
Scaffold_2809:1327- 2604
Transcript NameFunction/comments
Phypl_g15408hypothetical protein PHYSODRAFT_462863

Sequence
1277 bases(100 bases per row)
cgttcactgggagtttgtataaactccaaagcacacacttcctctgtgcaacgtgctcgtgtgacacTTGGTAGCACTTGTAGTCATTCCAACACATACG
CGGGTGGATTGAACTACCTGAATCCTTCTGTGGTCTCTAAGAAAGTGAGCCACCATGGATCGAGGAGAGTTTCCGCATTTGACCGACGCTCGTTTGAGTC
GGTCCGGAAGATGTCGGGCATCTTTGGGATGTATGCCTTCCGaagcttggcggcggctcCGCCGCCCGAGCGGGTCGAACGCCTGAATGCGTTGGCTCAT
CGCTCACGTGCAGGGGTTACAGCCTCCCCAGGCTGTGCCGAGGCCGGTCCAGCCGAAGCCCTTGAGGCTGAAGGTCCAGGCCTACGGCGGGAAGGAAGGT
GAGAACCTTCACTTCTGGGTCCGAGAGGTTGAACTCGCGATGGACGCGGCCCTACTCTCGGACGAGCGACTTCGTGTTGCTTTTGCGCTCTCGCATCTCG
GCGATCGAGCCAAGAGCTGGGCGTACACGCGTGAAGCGACGTCACCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTGCGAGCCGGCTTCCT
CCCGGCGAGCTATGAGTATCACCAGCGCTCACGCTTCCTTGCCTGCAAGCAAGGGAAACATGAGCTGCACGCGTACATCCAAGAGATGCGCGAGCTAATC
GCATCTCTGGTGGGGAACCCCTACCTGAACACATCAAGGTGACGGTGTTCATGGACGGACTCCGTGTGGGCCCTGCTCGCACGCAGTTGTTCCGCGTGCA
AGTCAGCACCCTGGAAGAGGCGATCCAGATCGCACTTCAGGAGGAGTACAGCCGCAGGCAGGCTCGTATCCCCACCATGGCGTGATACGGCCACGCAGGC
CCGAGCAGTAGCTCCGCCAGGGGTGATCTNTCCTGCAGGACAAGGGAGGAAATATCCCTCCAAGCCCTTTGCTCTGAAGGGGCGCTGGCAGAAGCCGCGA
CTTAGGGGCCAGGGGAACGCAGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGACCTAAGTCTTCATGAACGGTGCGCGGGTGGCGCGCACCATGA
AGGCTTAGCCCTTTGCTCTCTCGAACagaagaacggcagcggTGGGTTGCTCGTAGTACACGCACGTGTGTGGGGATAGGATCATCCTTTCCCAGTTTTG
ATTGGCTCTGGGGCGTCGAAGGACTTCGCACGCCGCCAGACAGTCGCGGATAATAGCGACAGGTTTGCCGATGCTCT