Description :
From Genome Similarity Track
Location :
Scaffold_730:13268- 16521
Transcript NameFunction/comments
g16114.t1hypothetical protein
g16115.t1hypothetical protein

Sequence
3253 bases(100 bases per row)
CGCTCGGCAGCTATTTATAGCCAACGGAAAGTCCGGATTTGCGTTACGCTCCGGGTGCGTACGGAATGACGGACAGACGGACGGACGGACGGACGGACAG
GTTACTCTGTTACTTGTAGGAGACTAGCCGAACGCCGCCCGCGTTGCGGGCGGTGGGTGCATGGTTGGTTGGTGCCCGTTCGCTCGCTCATCCAGCTCGC
TTCACTACTATTTTTGCTATGACAGAGTTATGTTTTATCTCAGTATATTTTACAGTAGACTTGTACCATAACCCTAAGCCCGCTACGGCTCGCAAGCTTC
GCCTTCGCTTGTCTACCATGCACTGTTTGATCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCACAGGCGTACTCGCTCCGCTCGCCTCA
CGTGGTTCCCGTGTGTACGAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGT
GCTTCGCACACGGACATCAAACCGCAGGCGTTCTCGCTGCGCTCGTCTCACGTGGTTCCCGTGTGTACGAACCCTAAGCCCGCTACAGCTCGCAAGCTTC
GCCTCCGCTTGTCTAGCATGCACTGTTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGGGTTCAAACCACAGGCGTACTCGCTGCGCTCGTCTCA
CGTGGTTCCCGTGTGTACGAACCCTAAGCCCGCTACGGCTCGCAAGCTTCGCCTCCGCTTGTCTACCATGCACTGTTTGGTCCTGGGTTTTCACCCGCGT
GCTTCGCACACGGACTTCAAACCGCAGGCGTACTCGCTGCGCTCGTCTTACGTGGTTCCCGTGTGTACAAACCCTAAGCCCGCTGCGGCTCGCAAGCTTC
GCCTCCGCTTGTCTAGCATGCACTGCTTGGTCCTGGGTTTTCACCCGCGTGCTTCGCACACGGACTTCAAACCGCAGGCGTGCTCGCTGCGCTCGAGGGG
GAATGGCGACTCTCAACAATTACCGCTATGCAAAGTGACAAATGTATTCCTTTCGTAAAATATGCATTCACACGAAGTCACTGCCTACGCCCTCTCGAAC
AGCTGTCGGTACACTATATTCGCCGTGTACACTCCGTCTTCTTCCTCCCGCTCTGGATACTCGACCAATGCCTTGAATCTCGATCTCGACGTAACCCTTG
ACATGGCCACATACAGCTGACCGTGGGAAAAGCAAGGAGTCGCCAAGTACAGTCCCAGGTACTGCACCGTTTGTCCCTGCGCCTTGTTGATCGTCATGGC
AAAGGCAGTCTGGATAGGAAACTGCCTGCGTCTCAGTCGAAATGGGAAATCGCGGATGTCGCCACCGCTGATGAACACGATGCGCGGGATCAACACATGC
TGGCCTTGCCTGTCGCCGGCCATGATGGTGGCGTGGATGACATGATCTTTGAGTTCGACGATTCGCAGGCGTGTTCCGTTGCACAACCCCAGGTCGGGAT
TTAAGTTCCGCATCATGATGATCGGCATCCCCTTCTTGAGTTTCAGCTTGTGGGGTGGGATGCCACTGATGTTCAGGGAGTTGAGCACCTGCTCGAATAA
GTTCCCGTCCTCGTCATCCTCCACTGAGTCCGTGGACACATATTCTCGAGCTGGTCCAGTCATGCGATCCGCTACGGCTTCGTTGATACGATGGACTATC
GCGTTCGTGGTGGTGAGGATGGTGCGACTCGCAAAGTACTCGTCCGTTGCGACTTCCGAATTGTTGATGTCGGCGTACATCTCGTCGATCATGCGCCGCA
TACCTCGCGGAATAGCTCCCGGACGGATCTCCTCGTCCTCATCTGGATCACCGGCGGGGTTGTCGATGAGCATGTCGCGTGGAATCTTAATGAAGTCATT
TCCCAGATCATTGTGTACCTCGTGTCTCCCCTCTCCAACCTCCAGCAGGTACTCGGAAAACGCAGCCATTTCTGCAGCACTATCAGAGGTGGCAGCCGTG
CGAACACGCATGTTCTCTGTCAGACGCACCTTCTGGAAAGTGGCCACAGTCCGGAAGACTTCAGGCATGCGTCGATTGTCTCTGTCGCCGAGCCGCCCTT
CACCACCGGGAGAATTTGCCTGAAATCTCCCGAAAGCACAACGACTTTCCCACCGAAAGGTTCTGCCTCGTTATCCAAAACATCACGAAGCGTTCTATCC
ACTGCCTCAAACGCGTGCCGATGCGCCATGGGTGCCTCGTCCCAAACTATCAAACTTGCTTTCTTCATCAATTCCGTGACCTGGGATCGCTTGTTGATGT
TGCAAGTAGATTCGCCGTCTATCTTCAATGGGATTTTGAAGGTAGAATGCGCTGTCCGACCTCCCATAAGCAGAAGAGAAGCAATCCCACTGGAAGCGAC
CGCGATTGCAATTTTTCCGGATAGACGAACCTTGGCCAGTATGTTCCGAAGCAGTGTCGACTTCCCGGTACCGCCTGGTCCATCAACGAAGAATAGCTTC
CTGCCTTCCTGTGGGTCCTCGACAGCTTGGGTGATCTGATCATAGGTCAAGCGCTGCTCCTCGTTTAGGTGGTCCTCCTCACTCACAATTTGTTCAAGAA
CAGACGCGTCATATCCCGTTAGCTCTCGTCGGATGAGATTGTTTTGCAGAACAGACTCAAGCACCAGGCGAGGGAACTCGCTCAGCCGAGGGAGATCAAA
GTCTTGGACAGAGTACCCACTGACACTGAGCAAGTCTTGGATACTCTTCAGTGTGTCGAACGTCACAACAGACGTTTTAAAAGGGTCCAACATCTCTCGG
TTCCTGTACGCATAGTCAAGCGAAAGGTCTTTGAAGAATTGGTCCCAAAGACCCCGAACATCCGTAGGCGCCGAGTAGACCAAGATTGTTGCAAAGAGCT
GGCGCAGCTGGTACGGCATCTGGAACTCGGCAGCCTCCGACAAACACAAAACCATTCGCTGTCGTTCTCCAGATAGCCGGCATGTTCAGCCGCGTCTCAA
TACGTGGGACACAGCACACCATCAACTGTCCGCAGGTCTTCGAAAGACCTCAGTCCTCGGCGATGGCATAATAGCAGGCGTAAATAGAAGCGCTCCATAT
CACGCGGTGAAACATGCACCATCCGACCAATTGCAGCCTGGTACCTTTTACGTCGAACCCAGCACTTCGTGTTTCCCATCCAGCGGAATTCCTTGGGTAT
ATCCTGGTACAGCATTGTCTTCGCGATCTGGTTCTCAGGTTCGTCGCTCGCAC