Description :
From Genome Similarity Track
Location :
Scaffold_2:132679- 140903
Transcript NameFunction/comments
Phyci_404032Hypothetical protein
Phyci_564279Hypothetical protein
Phyci_88964Hypothetical protein
Phyci_75816Hypothetical protein
Phyci_262850conserved hypothetical protein
Phyci_206957Hypothetical protein
Phyci_75819Hypothetical protein

Sequence
8224 bases(100 bases per row)
GAGCTGCTGGCAGTAACGCGGTGGACAAGGCGCTTTCCCCACCGGGACTTGTCAATCCGGGCTGGAGGACATATCGCGTCAACAAGTGTCGCGCTGAGCA
GAGACGTCACCGGCTGGCGGCGGCGGCAGCAGCAGATGCAGATGCATCCGCCTTGACAAGCGATTGCCACCGCTACCATACCATGCTTGGTGCTGGCGCT
AACCGCGGCCAATTTTTCTGCTGCGCTTGACTCACCGAGTTGTTGCCGTTGCCATGGATGAGCCGCTAAGATCGCCGCCGAAAATCTGAAATGAGCCGAA
AAAACTCACATCTTATCCGTTCTACGGTTTAACGCGCTTTCTGATTGGGTCAGACGGGATTCGATGTTGAACTCGGGCATCCGTAGAACCCGCTCGTGCA
GGTTGAACTGCCGGTTGACGAGCAAGGGCAATGCCCTCGGTCGTCATGTATCGCAGGGGCATCCAACCTTGAATTGGCGAGGCTCGGGAGAGACGGTCGC
CTGCTGCTTGCCTCTGCCAGGGCAGGTCTCGGGCTCGATTTGCGCGCTTAACGGCGCCCTTCGCTGTCATATAGCTAACGCTTCAGGCCAGTTTTGGGCT
CGGGATGTTACGCCGGAAGCCATCTGCATAGCGCAAAGGGTAAGCCCGGCCGCGAACTTTAATGGTCGAGGCTCGGTTTGTGATACGAAGTATCAGCTTG
TGCGGCTCTCCTCTCCCCTATGCCGGTCCCATTCCCCAACTTGCCCTCGGACTTGTCCTGCTCCGAAGGGCACTTGCTTTCCCCTGCCGGCAACCCGCGC
GAAACGACCTTGCCGCAAAGTGCGAAGTGGCTGAGTCTCGTCAGCGAAACTGAGCCTCGTCGCCACCAACTGCCTGCAAGCAGCAAGCAAGTAGCCCCGC
TGCTCCGTCTCTCACCGGCGAAGGCCCTCGGCAACTACGCGCCGAGCGCTTCGCCTGGTACGATCCCAACTGCGTTTCGCCCGCCCAAGATAGTCCCCGT
CGCACTCGGCAATTGGCTCGCCAAGAGACACACGCTACACACTCGAGTGCGCTAGCGCCCAACCACCGGCAGGCAGCAGAGCAGCAAAGCTCGGAAAATA
ATTTAAAGAACGGAGCCCGCCAAATCAGCTCCTACGTACGCATCGCACCGACGCGATGCCACTTTCCATCTCGTTTTACCACAACAAGCGCGGCGAGAAC
GGGGCCAGCTCGTACCAAAGCGTGGCGCTGCACGACCGGGAGAAGGTGAAGCACAAAATGGCGCTGCCCTGCGAGTTCTACCGCAACATTTGGGGCCCCA
CGGAGGAGGAGGACGCCGCGCTGCGGCGCCGCGCCAGGTCCAGCAAGTTCAGCAGCTCGCCGGCCTCGGCCACGTCCCGCAGGTTCAAGAAGCGGCTGGC
CACGGGCCCGCTCGTCGACATTGCGCAGGTGGCGCACGTGGTGACCACCATGTCGGACTTCCGCGCCGACTACGGCGAGGACTCGAAGCGCGCGAGACTC
GTCAACATCTGGGACGACCGCAGCCTCGCGCTGGGGCTGGAGCCCGAGGGTAGCTCGGACAAGTCCTCGCGCAGCAGCGGGGCCAGCGACCAAGGCCCAT
CCACGGCGGACACCGAGCCGGAAGAAATCATGTCACCCATCAGCCGCGCAGACAGAATCACCGAACTCAGCTGCGAAGACAGCGACGACGACATCAGCAG
CCTCGCGTCGTCGATGGTGAATCAGCGACCAGGCCAGCTGAAGCGAACCAAGACGCCGGAGATCGTGTTCCCCAACACCAAGAAGAACGCGAACGGCAAT
GGTAACGCCAAGACGGACAAGAAGGACCTCAGCTTGAAAAGCCTCCCGGTGCCTCCTCCTTCATCCCACAACGGCAGCATCATTTTCAGCGCCGTGTTCT
CGGAGCAAACGGACTGGAGTTGGAGCGCCAAGTTCCTGCTGGGGATCCACGAACCGATCCGCCACGCTCTGTTCGTGATGGATCGGTTCTTAGAGCAGTC
ACAAACACGGTCGAAACCGGAAGCTTCGCACACGCTGGCACTGGAGACCCACGTGGCGGAGTTTTTCCTATGGTTCAAAGAGTACTTTGTGGAGTACTTG
CAGTGCCAACACGAGGTGAAGGCGTCTGTCTTGCTACCGCTGTTGAATCTGCCCGTGACGACCAAGCAGCAGATTTTGGACGTGTATCAGGATATCTCGC
AGATGCTGACGCAGATACAGCAATTGGAGCGGGCGTTGTGTGTGAGTGGAGCATGCAGTGCATCGTCTTGGTTGCTACGTCTCCAGGTACTGCAAACTGA
GATCCGCCAGCTTAATCGAACGCTGCATGCGGCTCTCAACATGGAGGAGACGACTCTGCACTCTGCCATGAGCGCTGCGTTCACGGAGCGCGCTTTCCGG
ACACACATCATGCCTCGGGTATTCCGTGCTATCCGTGCCAAGCGTGTGGTAGTGCCTTGGATTGTGGAGCGAAGCAAGATCTGGGGCGGAGACACTGAAC
AGCGCAGCATTCAGGGCATGTTGCCGTTCTCGGCAAAATTCATGTACCGCAAGATCTGGCGGCCGTACTTCATGAGCAACGTAGCGGTGGCGATGAAGAA
CCTGAACGAGTTTGTCAGCGCTGCGGACTCGAGCAGCAGTGGGTCGATTTACAGCGAGCGCCAAGGAGAGATCTGCTCTATTATGTGAAGTGGTAGCAAG
GTGGCAGGGTTCGTTTCTTTCGTTTCTGGGCTCTACAGCTATTTATTATCGAGCGTGTATCGTGGCGTGACCTGGGCTAGCAGAGCGACACCAAAGTAGC
GAGTAGAAGCAGCTTTCTCTTGGTTAATAAAATCAATTGCTTCCTACTTCTAAGTATGTTGTTCAAGAGACAGCTTGTGTGCCTCTCAGCTTCTCAAATC
TCCGTCCGATTGCTTAACTGACAGATAGTCAAGCTGTGGCTGCGAATCGCAGGTCCGACGGTTGAAGCAACGTTGAAGTTCTCAGCCAATCAACTTCCAA
CAGCCGTTACTCGCTGCTGTGGTTTCACGGCCGAATTTACGACCGCTGGTTGGAACAGTGGCTTATTGAGCGAGCCTCTTTCATCGTTCTCATTGCCCAG
GACAGCCATAACAAGTAACATGACTGCTCTGGAGAGGAATCAAGAGCAGAGCGACGATCCCAAGCAGCAAGCAACCTTGAGCAAGCCGAGCGATCAATCC
GAAGATAATAACGCTCAACCAGATGAGGGTTACAACCGAGCAACTTCCATCTACGCGGAAGTGCCACGGGTAGCTTGGGAATGGATCTGCTGGTCCGGTG
CCAAGACGTTCGACGGCATGGACTTTGCGGGCGAAGTGCTCGCAAACTTCCTTGGGCTTACACAATCGAAGTACCAGTGGGTCCTCGACGCCCAGGAACG
CGAGGAGGCGGAAAAACAGCAGCGTCAACTTGAAAAGCGACAGCGTCGCCAACTTCGCCTCGAACAACTTCTGGAAGCAGAACAACGTAAACTGCAGGAA
CTAGAGACCGGTGCACTCGAGCAAGATGAAGAATCATCCTCCACAGTGTAGGCAAATACGTAGCCAGCATTTTAAATCTGGAAGTGCTTCTACGTTCAAC
GCTTGGTATGCGTATTATCGCTTCGTTTCAACTATCGATCATTTAGGATGATGTTAGAGGCGTACCGTCCTATCATCAACAAACCACACAATATCGTCGG
TGGCTAGCAACACGAATTTACAACATGACACATCTAGAAATCGCCTGCACTGTTGTGAATAAGTGTTTTTTTTCGTCTACCATGGAGCTGCGGCTTTACT
CCTTGCCGTCAAAGTTATCCCAAAGTGGATGTGTTGGCGGTTTTACTCCAGCGCGCACTAACATTCGCACAGCTGCCATCTCGATGCGTTGCAGCTGTCG
ATTCACGACACTCTCACTTTCAGGGGTGAACTGCTCAGTGCGGATTGCCAGGAGTCCTAAACAACACAAAGCGAGAGCGTTGGTCATCACCTCGTGGCGC
TGGACAACGCTCGCAACAGGAGCATCCAAAACAACTAAAGCGCACCGTTGAGATTGCCAAAAAGCACGTCTGTGGAGTACCGGTCTCCAATAATGACAAG
CGTCTCTGGATCCACTTCACCGAAGTGTTTCTTGACAAATGCAATGCCTCCAGGTTTCTGCACCACGGCACCCTCAAAAGTTCAGCCCCAGACTTCTCCA
AACATTAGCACTATACCCGCTTCCTACCTTCTGGTTGTGGCGCAACACAGCCACGTTGAGTCCTTTCTCGATCTTCTTGGCTTCCACACCGTCCTTATCG
TCCGTGGATCCCGCCGAGTTGGAGAAGATCACGACGCCGGAGTCCCCAAAAACGCGGCGACATTCAGCCAGTGACGACTCGAGATGCGGCGCAATCTCCA
ATTTGTGCGGCACCGTCAATGTGTTGTCCTTGTCGAATATAACGCCGCGGAATCCACGGTCGCGCAGCGTCTGGAACGGCACCTCCGTCACGTCTGAAGC
AGCGATACGAGCAGGAGAGCACGAACATACACGCAGAATTACGCCGTGCACAGTGGTCAAATCTTCACTATTTTCGCATGCATTTAACGACGAGAGAGCG
GATTTTACCTTTAACGGACAATTGCGGCAGCAGGAGCTGCGGCTGGCGCGTCAGCACGCGGCAGAACTCCACCACGCCGCCGAGATTGAGGCCTTTCATG
GTGGTCGAGCTCGCCTCAAACCACAATGGCTTCGCATTCCGACCAATGGTGTCGCGGCATCATCAGTTAAATCCATGATTCGTCAATAACCGTCATTTTC
CACCAATGGAGAGCCGAGGCCGTTTCGGCAGCCAGTGACGAGCTCAGAAATACTCGCTCTCCGTCACCCGCAAGACGCCAGAGCTGGTATCGCTCCCTCC
GCTCGACGGCGCTGTAGCTCCCCGGCCGCGCCCCCTGCAGCTGTTCTTCCGCCGCGACGTGGTTGCCCTGCGTCTCAGCTACCTATTCCAGCCTCCACCA
GCCCCTAAAGCCTCATAATGGCCGAGAACCCGCAGGAAACGCACATTCAGGAGGAGGAGGAGGACAAGGCCGAGAACTCGAGCTCCGACGACGACTCGTC
CTCCTCCAGCTCGGGCTCCTCGTCGTCCTCCTCCTCGTCTGACTCCGAGTCGGAGGATGAGGCCGAGGCCGAGAACGCCAACGCCGGCACTGACGCCAAC
GGCGCCAAACTCGCCGCTCCTCATGGAGGCATCGCCAGCCGCACGGGCCACGGCTACCCCGCTAACAGCACGGGCCCGGCACTGTCTGCCCCCCGCCCGC
ACGGACTTGCGGCTACAACCGAGAGCCTGAACGTGAACTCGACGCGAGCAGCGGCGAGATTCAAAGCTGCAGAGACGGAGTCGATGATGCCGCTGGGCAC
CCGCAAGAGAGACCGACGCACCATTGAGGAGATCCAGAGGGACTTGAGGGATAAGAGGAAGAAGCCACTGGGCACCCCAGCCGCGAGGTCGAGCCCTCCA
CCGCCGAGAGGGTCACCAGTGAGGTCCCCGGAAGCCGAAGCTGTGGTGAACAGTGGCGCACCGATGGCTGTGGGTGGACCATTGGGCCAGTTCGGGGCGG
CGGGACGACTGCCAATAAAGAGGAAACCGGTATCGGCGCACGACAGGTTGGCGATGAAACTTAATGGACGCAGGACCACAAGTGTCAAGGCGAAGAAGCC
GGCTAGCTCGACTACTGGGAGCACCACGGTGCCGCCGGTGTCGGTGATGACGAATAAAACTGTTACGAAGCCCATGACTGCAACAAGCTCTGTGGGGATG
GCTACAGGGAACAGTAGCAGCAGTGACCATGGAGGTGACACAGGAGGCGATGGATATAGTAGCAGCGTTAGCAAGTCATCGACGCCTGCTGTTGACGGAA
AGGTGGTTCGCGCGATGCTTCGTGCAATGCTTCGCTACGGGGATCTGACCGATGTAGGTCTCTACCCGACAGCTGCAAATTTCGCGGACGAGTACAAGAT
GCCCAACTTTATCGAGCGATCGAATCTGCAATCTACTACCAGGATCGCTACTGATCGGCTGCATACTCTTGCAAACGACGTCGCTCAGAAAGCCAAGCGA
GCGGTTGAGGCACGGCCACCGCATGATAACATCAAGATCGCCGAGGTTGAGGCACGATCGTCACAAATTATTGAACGCCTATATGAGAATCTCAAACTCC
GGGTCGCAGTTCAACGCGCCTTGCGGACCGCCGGCTGTTCTTCAGGGAATGCACAGGTGAATGCTCAAGGAGCATATGTATTAGTGGCGAAACAAAGCGA
TCTCTCTGTCTTGGGAGTTCACACCCGAGACTTACCAAATTGGACTTGGGCTGAAAAAGAACACGACTGGACACAACGCAAGGATGCAGCTCTGCTTCTT
GGTGTCTACGTCCATGGATTTGGAGGTTGGGAGGACATCCTGAACGACGATTTGCTTCATTTTCAAGGGCAACGGGCTCTGAAAGGCGAGCGTTTAAAGA
AGCGTGCGGAAAACCTATTGAAGAGATTACCTCCCCCTGATGTGGACGCTGGCGATCCGCGTATCGTCCAACTCGCTACTTCATTGGGTTCTGCTGGCGC
CAACTTGAATCAGTCATTGGGTGCACAGTTTAGTGCCATCATCCATGGTGGGGGTCCCATCGCTGGTGTTACAGCATCAATCCCCGCTGTTCCGGCTACT
GGAGGAGGTCGAATGGCACGTGCTGCAGAGCGATTCGCCGCACGGCAACAAAATGGGGAAGACCCAGCTAGTCGCAGGCACATTGGGCTTAACAACGGTA
CTGCCACGTCTAATGGATCAGATGCCGGGCGGCACCACAAAACGCCGGCCATGAGATCTCCTGTGCAAGCGAATGCTGTTGATAATGAGCCAGAAGAAGG
AGAAATTGGCGGGGCGTCACCGGCGCAGTCGACATCCTCTCGGCATAAGAGGCGATCATCCTCGGCCGAGGATGAAGATCGGGCGTCATCACGAAAGAAG
CATCGCAATAACAGCAGTGAAACTCCGAGTAAGAAAGAGAAGCGAAAGAAAGAACACCGACGCAATGACCAGCCTAAGACCGATTCAGAGACCTCAGCAG
TGGTGGCGAATGCTGTAGAAGATGCGGCCCCATTGCCACTGCTTTCAACCGACGAATGCAATGAAAAGTGGAAACCAAACAAGAAACTGCGCGAAATCCG
GCAAGTCCTCAAAAAGATGAAGATAATGGCCGACTGGTCCCGGAACCAAAAGGACGAGACTGTTGTTGAAAAGGTTTTCAAGTATGTTAGTACCATTGGG
GAAGAGATTGATCGCATCGTAACGCAACACCAAGACAAGGAGGAGCGGCACCATTCGGACGCGTCATCTCGCGAAATTGACGAGCTTTGCACATGCCTCT
GGACGTACGCTGCAGGCTTCACACCATTCACGGCACAGGGCTTCGAGCGCCTCTACGACGACATTTGTGCGGATGGTGATGCTCTCGTCGCAGCCAGATC
ATGACGCTGCGCGGAGGCCGTCGCAGCGTAATAGTCTTTCCTTTCAAGGAGGCTGCGCCGAACAGCCCGGTGCGTGTACAGAGAGTTATCGCAAAGAACA
GATAAACGTATCAACAAGATCGACTGCATCCTTGTTGTGGACGTAGAACATTTTTTCTGTCCGTTTCGACTGGAATTGGTCGCTGCCAGCGGTGACTGTT
TGAAGAGTTGTGCCGATAGGGACAAAATACTCATGATGTCCGTGCTGCCAACGCTGTCGCACCCCACGCCCACGGCGGAGGAGCTGGCGCTCAAGGAGCA
GGTAACTCAGGTCTTGACAAGCCAGGGCGTCCTCGCCAAGTTGAAGGCAGAACTGCGCGCCGCAGTATTTGAGGTTATGCATGAGCGTGAGGGGTTCGCG
AAAACGAATGACCCCACGGTCCCGAAGTTGAGCGACTTTCCCATTGAGACCAGGACGATGGCTTTGGCGCTGATTGCCGAGTGTCTGCAATTTTTCCACT
GGGAACACGCACTGCGAGTGCTTCTTGCCGAGATCAATGCAGAAGATGAGCAATATAACACAGCACGGATAGTTGATAAGCTCGGATTGACAAGTAGCAA
CTCGTCGGTCAAGCCGGCACTATTTCAGCTCATAGAGTCCAGGGTGCTTGGAAGTGAGCAGAGTGCTGTGTCTGTTGCGTCAGTGACGACCCTGAAGCGT
GGTAAATATGACGACGAAGGAGAA