Description :
From Genome Similarity Track
Location :
Scaffold_30:132642- 135088
Transcript NameFunction/comments
Hyaar_Emoy2804608tRNAdihydrouridine synthase 3 putative

Sequence
2446 bases(100 bases per row)
ATATAATCCCAGTCAGCGTTTTTCGTGTAGCGCTGTAACCGTGAACGGCCATGCATCATGATCGCGTCGACGGATTGCGTTGCACGGAGCTTAAAGTCAG
CAGTCACCACTGCAGCATTCACATAAGCCTGTGAAGCGCGCACGGCCTGCAGCTTGGGTACCAACTTGTGAGCAGTCGGTTGTTTGTCGCTCCACCCAGT
GCGAAGCTTTACGGTAAGCCCCGGTGTGTTCACAATACCACCCGTACGCATGCGCGTGCCAAGCTCTAGTCCAGTCAATGCACCAGACACAACCTCGAGT
AATCGTGGTGGACGGGTCATCAGTGCAGATCCTGCGCCAGTACGACACACGATATCGATCGGACAACCCATATTGATGTCCACGAAATCAACATCCGTCT
CGCGCGCAAGAAGCTCGCACACACGGGCCATTTGGTCACTATACGACCCCGCAAGCTGCACACCGAAAACATCTTCACTCTTATGACGTCGCAGCAACGC
CCACTCTGATTGCTGAGCCTTCAGCAGATTTGTGGCCATCGCCATTTCACCGCATGTGATATCGGCTCCTGTTTGTTTCATCAAGCGACGAAACGGCAGG
TTACCTACCGTCGTGAGCGGGGCGATGTAGATCTTGCGCTTGAAGTCAACGGGCTTCCGTTCAGATACCAGCGCGCTTTCAGCTGCAGGTTCGATTCGGA
CGCCTTCCGAGGCACATTGTGCAGCACTTGACTCCGGTAGCACTGGTTCAGAACGCGGGTCCAGCTTGTCTGCAGTTGGATCCTCGCCGGTCTCACTTGT
CCCAACTATTGACGGAACCTCCTCTTCGTGTTTGTTTCGCTGCTGACGCTTCCGACCACCGCCGTTCTTCTTTACATTCTTCATCTGCTGCTTCGACTGG
AAGTCGTACGTGTCTTTACGCAGCTTCAGCCGCAAGTCATGAGTGAGATCGTTCGTCTCATTGCCCAAGTCGTGACCCTGCATCTGAACATACCCTTCCC
GCTTCACATTGCGATACACCCCATCCACGCACTCAACATGTGCATTGGCAAACCGACAAGCGACGCCATAGCGACAGTAACCAATGGCCTCAAACACCGG
ACAGCGGTCGCCGAGATCCTTCGGCTTGCGCTTCATGTAATCGCTCATGTCATGACTGAACTTGCAGTCGTCACCAAACTTGCAGCCCTCCCCAGAGGCT
ACAGGACGACACAAAGTATCTGCCGGGTCTTGCTCCGCATCGATTGGGCGCTTCTTGAAGGTCCCGCCGCGTTTCTTCTGGCCACGGTTGCGGTCATCCT
GCACAACTGGTTCAGTCTTCGTATCCTTCGTATCTTTGTCTGTAGTGGATGTCGAAGCTCTCAGTTGTGCCTTGGGCTTCAAAAACCTGTAAACCGATTG
CATTGGGTGAGGATTACGAGAGAGAGAGACAGATGGAAAGATGTATTGGTACTACGTGTGGGCTGTACGCACTCTTTTTTTACCGGAGCTTCACCTGCGC
GTCGCTCGCGCACTGTTGCTTTAGGTGAGATGAGTGGGCTAGTGGTTAATGCCTCAGAGGTTCCTCTAGACGATATCGCTTGGTGCTCCATTTTAACTGA
TCCTTTTCGTATCAATGAATGGACACAAGCAAAAGGTTGAGTGGACACAGCATGGACGACACTTTTTGAGCCTGTCAAGTTTTTATTCTAGGGAATACAG
ACCAATAGCTGGAGAATAAAAGTACTTGGCCACGGATAAGGTCCGACGTTTTTAGGTGGAAATAGGGACGCGCTGCTTTGAATAGATGGGTTCATTTGGT
AGCAAGTTGAAGCGTTCGATTCGTGAATGGCTTCAATACGCTTCTCGCTCAGCAATGTGAGCGACTTCTAAAAACATTGCCATATCCGCAACCTGTCAAT
AGATCATCGATCTTCACGATGGGAGAATGACCAAGCAGATTATTTTGTAATTTACAATATCAGGAGGCAATGCACGTGAAGCAGGAAGCTATCGTTTAGC
CACAGATGGGCTATAGCAAAATCTGTACAAAGGTATGCATAAACCATCGTTTATCTCTATTCTGTATTCATTGCTAAGGATGTCTGTGTCGAGCCCGTCG
CTGCCACACCAGTCGCACCTTCTTCTGGTGCACGCTAGTATCATCGCGATACGTTGTTGTACGTCCTGAAAGAGTTCTTGTCGTATGTTGCGACGGTCGC
TTAGTTAGTCGTAAAGTATTGAAGACATTTAGCATATCAGCTGTTAAGAAGTTGTATACGCCTACAGGAGAAAGTGACAGGGCTCGATGAGCATATTTTG
TAAGTTGAAGCGTCAAGGGCCATACAGATAATCACAGCTACCCTCGAGTAAGATCGTCTCATGTCGAACGCAGATACGGTGCTAAACGGAAGGGAGACTA
GACGTGATTATTCCGAAGGTCGATCTATACAACTTACCGCCCCAAG