Description :
From Genome Similarity Track
Location :
Scaffold_3:13260- 17417
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.2Conserved gene of unknown function
Pytve_DAOMBR484maker-pve_contig_3-fgenesh-gene-0.26AP-3 complex subunit delta

Sequence
4157 bases(100 bases per row)
ATGGCGCCTTCCAAGCGACTGAACCTGGCGGCCGCGAGCGACGACGATGCTTCGTCGTCGGCTTCGTCGAGCGACTCGGAGACGCCGGAGCGTCAGCAGC
GCCGCGCCGCCGACTCGGAGGACGAGTCGCAGACTGAGGACGAGTCCGACGAGTGCGTAGGGCGTCCGTACACTCTGGCGACGTAACGCAGGAACTGACG
GCAATTGCGCTGTGTGTGTGGATGGTATCAGGGAGTTTGAGATCCCTCCGGGCTTCGAGAGTGTCAAAGGCAGCGGCGCCGTCACCCGCGAGGCTGTGCT
CGGACCCGACAAGGAGCTTTGGTTTTTCAAGCTTCCGAAGAACGTACGTAGCGCTGGCGTCGCTCCATGAGTAGCTTGTGCTAACGGCCGTTTGTATGCA
ATAGCTGGATGCGGCGGCGCTCGGAGACGTGGCGTTCAAGGTCGACACCAGCAAGGACGAGGAGGCCGGCACGACCGTCGCGAGCGTCACGGTCGGCGAT
GACCACAAGGTGTACACGCTGCAGACGGAGGACTCGATGCTGGCTGGACAGCTCGTGAACGCTCTGCCGCTGTCTTCCGACCGCGCGCGCTTCGTGTTGG
CCAAGCCGTTCACGCGATGCTTCTCGCTCGTCGAAACCCACGGAGCTGTTATCGCCAGCCATAAGCGCAAGGAGCAGCCCGAGGCACCTGTGGCAGATGC
CAAGAAGCACAAGAAGAAGTCCAAGAAGGAGCACGGCGACAAGCCCCGGAAGCACAAAAAGTAATAAACGCGCCAGACTTGTTGCCCAGGTCACACACCT
ACTCGCCTGCTCTTCACTGGTCCCTGCCGTCACTTTCACGCGTTGCAACCTGGGGTTGGAGACTCATCTAAAACAGCAAGAGCGGCTCGGCGGGCTGCTC
GCTTGCTTGGTGGTGCTTGCTTTTGTGCTCCTTGCCACTCTTGCGCTTGTCCTTGCTCTTCTTCTCCTTCCGAGACTTCTTGTCCCCATTCTCGTCCTCG
TACTCGGCTCTGGAACTCGACGTGCTCTTCTTGCTGCTCTTCTTCTTCTCGTGGCGGTGGCGATTGTGAGATTCGCTCTCGCCTTCACTCTCTCCGCTGC
CGATATCGAGCAAGTTCTCCTTCGGCTCGTGCTTGCGCGAACGCTGATGCTTCTTGCTGCTCTTGCCGTCCTCCTCCTTGCTGCTCTTCTTCTTCTTCCT
GCTCGCGTCGCCATTCTTGTCGCTCGACTTTTTGGACTTCTTGTGCTTCTTCGATGACGTTTCCACCTGTTCCCGCGTTTGCCGATGGTACAAGTGCTCG
TCCGGGATCTTCTCGTTCTCGCCCAACGGGATACTCAGATCGACAGCCGCAAGATCCCCACCCTGCTCCGATCCATCGACGACAGTGAGTCTCCAAGCAA
ATACACACGAGGCACACGGTTTGAACGCACATCGAAGCCAAGACCCTTCTTCGATCGCGGACGATCGTCGTCGCTGTCACGAGCTCCATCCGGCATGAGC
TCGTCCTCAAACACCGCCCGCGACTTCTTCGACTGCATAACAGCAAACCCAATGCTCGCGTCAATATAATGCAACACCAACACATGCCAGTCGCTGCACC
GATCCGCACCTTCGTAGACTTCTTCTTCTTCTGCTTCTTCGTCGCATCCAACGCGTCCATGATGTCCGCAAAGCCCTAGACACAACACCGCACGATGTCA
GCACTTGTATCATCCAGCTCAGTACAAGCAAAGAACTCGTACCCCATGCGCGTTGCCATCGAGCAGGTTGTTGCTGTTGCCAGACAGATAGAACGGATCG
GTGCGAAGGCGCTCCTTCTCGAGCATGTACTCGCGCTGCAGCCGCTCCTTCTCCTCCTCGGAGTCCGCTTCTCCTTCCGACGACGACCCTGACGATGAAG
ATCCATGACCATTGTGCCGCCGGGACGACCGGTGCTTGTCCTTCAACTTCTTGCTCCCCGACTTCCGCGGTGGCGTGGTCTCATCGATTCCACTGTAGCT
GCTGGTGCTTCCGAAAGTGTGGCTCGACTGCGAGACGAAAGAGACCTCGAGGTCGTCCTCGTTCGCATACGAACTCACGTCGCCGCCGTTCTCCAGGAAC
GACGCCTCTGACGAACTGAACGGCACGTCCAAGTCGAGGTCGCCAGGTGGTGGCACCTTCCGTTGTGCCTTGACACCAACAGGCGCCAGGCGTTCGGCAA
AGTACGAGTTGAGGATCTCGAGTCGCGTGGCCGCATTTACACCGGAACTGCTGTCGAACGCGCGAGAGGCACGCTCTTGCGCACTCAAAGAGCCGAGGCC
GATACCGAGCGCCAACAGAATCTGCTGCAGGCATACAGCGCGTTCTTGGACATCAATGTGCTCGCTCTGGATGAACGCGGGGAGCCGATCCAGCACCATC
TCAGCAACCTGCTCGACCGTGGCATCGTCGGCCTTCTCGGCCATAGCGTTCACAAACTTGAGAAGCGTCTGGACAAACACGGCCTGGACATGGCCAGGGA
GACTCGTGGTCTTGGGTTGCAGCATTTGGTCCACCAAGTCAACAATGCGGTCGAGCTTCTCTTCCTCCGTCTCGCGGTCGTCGTCCTCGTCGTCCTCGTC
ATCTTCGTCATCGACATCCTCGAGGAACTCCATCACATACTCGCCCGAGATCCACGCAGCCGCGTAGAACACTTCACAGAGCGTCGAGGCACCCGGTCCG
CTCAGCGCGTCCCGCTCCATGAGCAATTCAATCATATTGTCGACCATGACACTGCGCACCGACTTGACTCGCACTGCAATGTCCACGAGCTGACGAGCGA
CCTCGACGCCATGGTTCCTCGTACGCAGTTCGTCACCATTGCCTCCGCCACCGAGTCCAGCAGCAGATCCGTCGATGGGAGACGTCGCGCCGTGGCCAGG
CACGCGTGCGAGCTGCACGAGCACGTGGATATACCAGTCGAAGTCGTGGATGTTCTCGTACTTGTTGACCGAGCACACGTGGAGGATGCGAGAGATCAAC
TCGCGGCGGTACGCGCCATCCGCTGACAGCGTCTGACGCATCAGCTCGCGGATGATCGGCGCCGCGTTGTCCGGGTTCACCATCCCCACGAGAAGCTCAA
GCGCGCGCATACGAATCGTGATGTCATCAACAGCGAGGCACTCAATGATGAGCTCCTGGTGCTCCGAGATGACGTATGGGTGCGAGAGCATCAGGTTCCC
AAGACCAACCAGTCCGAGGTATCGCAGGTTTTGATCCGGATCTTCGATGTAGCGGCGCAGGTGATCGTTGCAGAGACGCACGATGGCAGGCACGTTCCGG
GGCTGAGACCCATCGCTCTTCTTCGTGTACAGCAGCGCAGTCGTGACTGTGGAGATGCACTCGTAGAGCAGCGACTTGGCCGGCGTGTTCTGAATCACAG
TCGCGAGCGGATCCAGCAGCTTGCGCGCGAGACGTGGCTCCTCCGGCACGAGACTCGCGAGCAACTTGACGACCTTGATCAGCATCCAGTTGTTGGACGA
CGTGGTGAGCAGTCGGAAGAAATGCGGCGCGAGACCCAAATAGTTCTTGGGTTTCTTGTTCGCGAGCTCACAGATGACGTTCACTGAGCAGGACACGACC
GCGACCTCGGGCTCCTCCATACGCTCCTTCAGCTTGTCGAACGTGAGGCGTAGACCCTGCGGGTACCGCAAGTACAGCTTGTACAGCACAAGCGTCGCCT
TCTTGCGCACGTACGCCTTGGGAGAGTGCATCATAGCAACGACATCACCAAGCAAATCTCGCGCGAGATCGGTCGTGGCGATGTTGGCCAGCACGTTGAT
CGCGAGCCCGACCTCGTACTCGTTGATGCTCCCAAACTCCTTCTTTAGCAGGTTGGTGCACAGCAGCACGACGTCCGTTGACTGCGTAAAGCTCTGGCAG
GCGGCCGTGTACCCGATCCGCTTGTGCGCGAACCGCTCGTAGCTCATGACCTCGACGACGTGGAAGGCCGCCCAGCACATGTCGTAGCCGAGCATGTGCA
GGTACGTGAGCTTGCGCACGGCATTGGCCTTGATGAACGGGTCCGTCGACCGAAGCTCGGCCTTGATCTCCTGCAACGCCTGAGAAATGTACACGTTCAC
GTCGCCCTTGGCCGAGCGGATGCCCTTCACGAGGTCCTGCAGGTTCTTCTCAAACAT