Description :
From Genome Similarity Track
Location :
Scaffold_433:1326- 3455
Transcript NameFunction/comments
Albla_Nc14130930
Albla_Nc14130940conserved hypothetical protein

Sequence
2129 bases(100 bases per row)
CGATGGCGATGTATACGAAAATGACAGCCACAGGATCATCTCTGATCGTAGCTCCACGGTCGATATCGAGAGATTTAGAGTCCAGGATATCACAATCAAT
AGCGAAGATAATGAGTAAACATGACATATCGAAATTGACGACCAAATTCGTTCGACAAACAGTTGAAAAGGATGTCCATGTGAGTTTGAACAATCACAAA
GAGGTGTTAAAGCGTCTGATGCATCACGAATTACGAAAAATTCGAGCACAAAAGGTTTGATCGACTCTCTATCACTTTACTTCGATTAAAAGAATGTTCT
CAGGTAGCCAAACGTGTGGTTCCTGCTCCGTGGCGCCTGTCACAACGTCGTGAAAGTGTCAAAATGGCTTTGGATTACATTTACAGAAACTTGACGTGTG
ATTCGTCTCAATTTGATGCATTCAGTTTGCATGCAATTCAGTTCTTTCACGATATACAAATTGTGGAAAATGGTGAAATACAAGAAGCATGTGTGCTGTA
TGCCAGGCTTTTGAGCTCCTTAAGGCTGAGATCAGAGCGATTTAGAGATTTTAGATGGGATCCTGACTCTGTTCCGTCTCCAGAACAGGTGAAGAGCATG
TCGAAGCTTTGTATTTCCCATCAGCTACTAAATTCAGTGTGCTTGGCTAGGTTGTGGAATTGATTCGGTCCGTCTTTACGCTCGAACGAGTCGGTCTGGC
TCATGTTTATCGATCCCCTCTTCTTTCATTCTTTGACAAGCTTCCGCCTGCGTTCAGCTCTATGGTAAAGAAGTTTCTGAGTGACCATATTACGCAACCA
ACCCAGTTACTTTCATAATAGCACTATTTGGGATGGAGCCCATCGCTTGGACCTCCATCGTCCTCAGATCCCGAAAAGTCGATATACGATCAGATAGCAC
AAGCAATTTTACTCACGTATTTTGCACGTGCACTGAATATTTCCATTGGATGCTCAATTACTCAGGTGATTAGCCCTGTGAGCATAGATTTCCCATCTTT
TACTGAGAAAAATGAATTCAGGTCTTCCAGTACATTCCGGATTTTTACCCTTACAAGTCGCATGCAGAATTATCAAATAGTGAATATCGTTCCCAGTTTC
ATCTAATATTCCTTATTGTCATGGTTGTGACAGACTTTGGAGCTTTACGATGTGATCAGGTAATCAAATTGTTGTATGTTCGAACTCTCGAGCATTTTTT
TAGCGTGAAGCTCTGTAGGAAATACTACCTCATGAGTATCACTATCTACGCAGCCAAATTCCACAATTGGTTGTTCGCCAAGATTTCGCGTTGCTTGGTG
AAGCCGTCCGCGTAAATATGCTTCTCATCTTTCCTTGAACTTTGTACTGATGCAATGCTATGTAGTCGCTAAAGTGCTTTCCAGGATCAGACCACAGAGA
CCTTGTACGTCGAGCTAGCGCGATGCTTCTAACATCCCAACAAGACGATGGATCTTGGAGGTCGGTCAACGAGAACGACATGCAAGAAACATACCACACG
ACAATGAGCGCTTTGACTGCTTTAATTGAACCTAGATGGACTGGATTTGCGCCATCAATACCCGAAGTGACTTCATTATTGGAGACAAATCTGAGTGCAA
TTATCGAATCAATCACAAAGAATAAAAATTCGTTACGTCCCAGCAAATATATGTCGAGTCCAAGCCGAAATAAAACACGACCATCAGGCGGCTTTGGTCC
TCATCCGAAGCAAATCTCCCTCGATGCTCGATTGTCACACGATACTCGGTCCAATACAGCAACTAGCCTCAAACGCACAAATTCCGACAGCTCGTCCAGT
AACTCGTCTAAAAGTGTACAGAGCACTCATGCACACACAGCCTCCTCGCATCCTGATCTAGTACCACAAGAAGACTTGGGCAAGCAAATAACTTCCTTGC
AATGCATGTTGACTGACGCAGGAGATGTCAAGAATATTTTGTCATCTTTGGCAATCCACGTGTTAAAGAAGCTTTCTGGAATGACACTCAACGTTGAAGT
TCTTAAAAGCACAGGCGTTGGTCGGATCATCAGCAAATTGAAAAAACATAAAGATGGTGAGGTTTCAAGATTGGCTCAGATTCTTATCAAAAAGTGGAAG
AGAGATTTCTTTTAAGCCTGGAAGCGGAA