Description :
From Genome Similarity Track
Location :
Scaffold_2292:1326- 3101
Transcript NameFunction/comments
Phyta_totarag14336hypothetical protein

Sequence
1775 bases(100 bases per row)
CCCACTCACGTCTCACGTCTTGTTCAGTTCTCGTTTGCATCGGTCCGCACAAGTCACAACTAGCTCCGCGCGGTCAGGTCTCCAACAGCCAGTCATGCCT
TTGGTCAACGCCGATGTGGACGTCCCCAAACGCCTGTCGTTCTTGAGTACTGGCTTGCAGACGAAAGACATTGAAGACGGCTATATCGGACTCAAAACAC
CCGAAATCGACGGTGGAGCCCTCCGCGAAGGAGGTATGCCTGTGCTCACCAGCAGGGACAACCTCGGACCTCTCTTCTAGTACGCCACTGTCGGTCTTGT
CTACGGTTTGCTACCCGAAACGATCTACCCGTTCATGCAGAACTACCTCAACTGCTCTGGAGCTCAAGTGACTGCAGTTCAGCAACTTATCGTGCTACCG
TGGAGTTTCAAGGTCTTCTACGGCATTCTGTCCGACTGCCGACCCATTTTCGGCTATCGGCGCCGCCCATACATGCTCATCGGCTGGGGTATCTGTTTCA
TTATGTTGTTGATCATGGCCATCATGCCTATCGGTCAACCGTACTTCACTGTTGCTTCGGACCGCGACATCGACATTGCCGACTACACACCAGAAATCGA
AGCCCGTCTTAACCACAACGCCCCCGACGATGGCGCCAAGTACGTCATCATCAtgctgtttgctgctgtcgggTACGTGTTGGCCGATGTCTGCGCAGAC
AGTATCACGTGCGAGTTGGCTCAACGCGAGCCTATTGACAAGCGCGGCAAAACACAGTCCTGTATTTACACGGTCCGAACTGCGATGGTGATCTTCGGCG
AGATCCTAGtgggtttcttcttcaacggcGAAGATTATGGaggcgacttcgacttctcgCTCAGTTTTCCGCAGTTGATGATCATCGTAGCAGTGCTTAC
ACTTCCAGTGTTCCCGATGACGTGGTTCTTcatcaaggaggagaaaTCCTCGGCCGCGAACTTCAAGGAGTACATGAAGAGCTTCTGGGACTTGTTGTGC
TCCCGCGCCATGTACCAGATCATCGCCTACCTGTTCTTTTCCGGCATCTTCGCCAACATCACGTACACTGGTAGCTCTCCAGTGGCATCGAAAATGGTGG
GCGTCACCCCAATCAACAGCACATTGAGTAGTATTCTCAGCAACCTCTTGTTCGCCGCAGGAATCATGATCACTTCGAAGTGGGGTCTGCACTGGAACTG
GCGCTGGATGACCGTCGTCACTGGAGTtgtggtggtcgtcgtggaCTGCACAGTGTCGCTTCTTGTTATCTGGGACGTCTTCCGGAGCCAGTGGTTCTGG
CTGGGTCCCCCCATTGCGGTGCAACTTCCGTACGGCGTCGGCTGGATCATTTCGACGTTCTGCGTGGTCGAGCTCGCTCAAATCGGAAATGAAGCTGCGG
TCTACGGCCTAGTTACCACGGTCACCAATGTGGCTCAGCCTTTTGCGACGTCACTAACCCTTGCGATCGATGGTCCGTTCAGCGTCACAAACGAAAGAGT
GCAGGCCGATGACCACTCGGTTCGTGCCGACATCACGTacaccatcatcatcatgtACGCCATGACCATCTTCTCGTGGGTTTTCCACTTCCTGCTGCCT
CCACAGAAGGCGGAAACGCAGGAACTCGTGCGCAAGGGTGGACACAGCAAGCTTATCGGTGGCGTCACAGCGTTCTacctcatcttcgccatctttTGGT
CCATTATGACCAACATCATGGCCATGTTCGACAGTACGTCGTGCTTGATCATTGCAGGTGGAACCGGTTGCTAAT