Description :
From Genome Similarity Track
Location :
Scaffold_84:132599- 169807
Transcript NameFunction/comments
Phyci_234922Hypothetical protein
Phyci_589107adenine phosphoribosyltransferase, putative
Phyci_537937Hypothetical protein
Phyci_537938Hypothetical protein
Phyci_234795predicted protein
Phyci_68772Hypothetical protein
Phyci_95150protein kinase putative
Phyci_316911conserved hypothetical protein
Phyci_316915conserved hypothetical protein
Phyci_95151conserved hypothetical protein
Phyci_95152Hypothetical protein
Phyci_234904hypothetical protein
Phyci_316925Hypothetical protein
Phyci_538108Hypothetical protein
Phyci_538121Hypothetical protein
Phyci_234821conserved hypothetical protein
Phyci_95156Hypothetical protein

Sequence
37208 bases(100 bases per row)
ATCTGCTCCGTGGCGCGCGCCTGCTGCTCCACCATCTCCTGCAGCAGCGCCTTGAGCTCCGCAATATTTGTGGGGTCAGTGTTGTTCAAGACTGCCGAAA
GTGACGCTGCCTTCGGCGTCTTGTGCGGGGCGCTGGCATTGGGCGAAGCTAGCTCGGGTTCGCTCGTAGGGGTGATGAAGCTCTGGGTCGCAACCTCAGA
GGGAGCGGAAGCTGGCGACGACGGTTCGCTGGAGCCACTTGAGGAGTCCTCATCCTGGCTAGTAGCTGTGCGTTGGTTCTCTCGCTCCGCCACCGCATTA
ACCGCTCCAGTGGCGATCGCCACGTTCTGCGCAAGCAGAGCGGCACTGACAGGATCCCCACCATCCAGGAGCGTGACCAGCTCCGTCATGAGCACTTCAA
GCTCACCCGCAGGGGCCCCCTTTGGTCCGACAACCCGTCCATTGTTGCGCTTGACGCGCTCGCGGTACTTGGACACCAGGTTCTCGAAGCGGTAGCGCAC
GATCGGGCCCTTGATGTTGTCCTTGGAGAAATCGGGGCTGTTGTCCAGCTTGTTCGCCACGTCTTCCCAGGCCGATGAGATCGCGCCAAACTTGGCACGG
AACGGCAGGGATTCCTTCACGTACTTGACGAGCAACAGATCGTCGTTGGGCGTGAACCGCTGGCGGGTGGCCTTGGTGACAATAGGCAACGCCTGGTCCT
CGGAATCCACGAGGAGAGAGGTGGACGACGACGGCGGCTGCGGCCCCAGCGGGGACGGGGCGATGGCCACCTGCGAGGCCAGCAGAGCCGGCTTCTTCCC
CGCAAGGGTGTCGTCCGGGCGGATCTTCCTGGGGCGGCCGCGTTTGCCCAGGTTCTGCGACGGCGGGTCGGCCTCGGCGGCGTCCAGCTTGGGGATGAGC
TCGGTCATGACGCTCTGGAAGGAGGCGTCCTCCGAGGGCGCGTTTTCCGGGCGGCTGCCGCTCTTGACCCAGTCGCGGTGGCGAGCCACGAGGCGCTCGA
AGCGGTTCTTGGCGATGGGCCCCTTGAGGTGGTGCATCTTGAAGGCGCTGCAGCCGTTGAGGGTCGTGGCGACCTTCTCCCAGCCGGCCATGAGCCCGCC
GTATGGGGCGCGGAACGGCTGATCCGTGTTCACCTGCACGGCGAGCAGGTAGTCCTGGCTGGGCCCGAAGCGCTGGCGCATTCGCTGCTTGGGCGGCATG
GAGGCAGGATGGTTCGCGCGGCGGCGGCCGTAGAGCTACTTCTCCCTTGGCGCTTTTTTCGTTTTTTGATTCCAGGCCTCTACTGGACGCGCCAGATCAC
ATACCTCTCTGTTCGGATACTTACTCTACGCGAAAAGACAGGCTATAAAGAATACGGTGTACGATTTGTATGGGATCATCAGAGGTCGGGAAGCGGCGGA
GCATCACGTCTGGCAGGTCGGCCGACGGATTCAAAAACGAACGTGGGATTTCGAAACTGGCCTCGCCTAAAACTACTAGCCGCCTGAACCTAAGTGCTAG
ACGGCGCCCCCACGCCGCCTACTCTACAGACAGTGCACGGCTCTCTATGCTCACATCTTCGTGAGGCCATACAGCGGGATGTTTTGCAGCGATTCCTGAA
TGACATTACGTACACGCACAATTCGGTGGTCAGTTAGGGGCGGACCGTGCAGCAGACGTCGAGCACGACGAGCACTCACCGTCGAGTGCAGCGAGTTGAT
CACGCAGCCGCACTCCACCACCTTGCCGCCGAGCTTTTCGACGAGCTCGACCGTCACCTTGAGAGTGTTGCCCTGCAGGTAGGCAACACAGCAAACACAA
CAAAATGAGCCCTCGACTAGCGAAAAGCGCCCAAGAAGTGACGGGATTCACACGATCCAAACGCACCGACGCAACGAGGTCGTCGATGATCACCACGCGC
CCTCCCTCCGTGATGGCGTCCTGGTGGATCTCCATGCGTCCGGTGTAGAAGCCCGACACGTAGTCCACGCCCACGACATCGCCCGGCAGTCTCCGCGCGC
GACGCACGGGCACAAACGCGGCCTGCAGCGCCAGCGCCAACGGTGCTCCGAAGATGAAGCCCCTGGACTCGCAGCTCACCACGTGCGTGATCTGCTGGTG
CGCGTACCGGAGCCGGAGCGCCTCGATGGCCGTCTGGAAGGCCACGGGGTCCAGAAGCAGCGACGTGACGTCGCTGAAGTCCGCGCCGGGCTTGGGGAAG
TTGCTGAACACGCGGATCTTCTGCTTGATGTACGCGGAAACCTCCTCCTCGTTGGACAGGTCCGCGGGCGGCCGCGTTGCGAGCTTCTCGCCGCTCATGC
TTGTCCAGCTGATGGTGCTTCGTTGAATGCGTGCACCGGAGGACTAAAATGTGTCGTGGACTATATTTTGACCAATCAAATTGGACCAAATCACTGCTCA
AAAACATGTTTGCTGCCGGGCGGAAGGCCTCCGGGACCGGAGCTGGAGGTGGCGACGCTGCTCAAGTCAACGATGGTGCGTTGTATAGAGGCTACGGATA
GCAGTGGTAGACTGGTGTGATGTCGTAATAACCCGTGGGGCTCCTGGTTGCTGTTCATTTAGACTGGCTGAGTGTTGGGAAGAGCTTCGCCAGCGGCACA
GGAGAGGACAAACCCAAGGCGAGGCGTGAAGACACCGAGGCATCCGAGTCGGCATTGCAAGTTTACAAGCATAGCAAGCATCGACACAAAGagaagaaga
agaagaaagagaagaagCAGCGCTCGAGCGATGTGGACGGTCGCCATCTCTCGAGGCACAAGAAGAAAAGCAAGGACAGGAAGCGCCGCAGGTCCTGGAG
TCCGTCAGGAAGCAGCGACGAAGATGATACGCATCGCTCTAGACGCCGCTCTCGTCGACGTCGACATCGCAGCCGCAGCAACTCGCCCTCGCGATCTACG
TCCCGGCCGCGCAGCCATAGGGATGAGAGCCGCATTGTTACTCAATCGGATAAAGCACTTGCGCTGCACGAAACACCAGGCGAAGAAAAACTGTTCGAGG
TCGATTGCGTAGGCGACCGCGAAAATCGGTTCTTTGGGTCGACATACGCGCACGACCAGCCACTGTACGACCTGGCCACACGGCGCAATCTGCTCACTGG
AGCGTGGATATCGCGAACACGCCCGAAACTGAGTGGCGTCGAGATGCATCGCAAACAGAAAGAAAACCAAGGGTCGGATCGATATTTCTCCGTGCGGGCA
CGCAAATTGGAGAGAGACGGTCGACAGAAGCGGCTATATCTTGCGTACTCTGAAAAAAGATTATCTCGCGCGGCATCTTCACACCAGGCGGACCACAGTG
ATCAAACTGCAAACGTCGTTGTGAGCTGCCTACCCGAAATGTCTTTCATTCCCGTGGATCCCGTTCTTGAAATTAATAACCTCGTGGGTGACGATATTGG
GGATCATAGCACCAGTACCAGTGATGAAGTTATGCAAACTGATGGGCAAAGTGTGGAGCAACATCTCGTCGATCGGAGTAAACTACTCAATGCCGCGGTA
ACTGCGGATCCACGTGACACTGATAAATGGCTCGATTTGATTGCCTTTCAGGAACAAACGATTCGTCTTCACACCAGAGGCAAAAAACTTGATCCAGCCG
TGAGGGCGAGTGTCGTAGAAAAGCAATCTGCAATTTTGTCGAAAGCTCTCACCTACAATCCTCAGTCTCGAAGATTGCATCGCGTGAAACTGAACATGAC
GTTGCAAGCTCAAATCAAAGGTGAAGGTGCTGCATTCGACTCGTTTCAACGGCAGCTGGAAACTCTGCTCCTTGATGATCTTACCAACTGCGATCTATGG
CTCAAGCTACTCCAAAGTCGCCAGCAGCATTTTGGTAGCTTCTCGATGCAATCTGTGCGTGATCTGTACGCGCGGATATTGAATGTTTTGAGGGTCGAGA
CCGAAAAACAGGCGAAAACTAAGGCGGAATCTGCCAAGCCATTGCACGGGGTATCTGAACCATTACTGCTTACCACAAAATCAGAGGACTTGGCGACATT
ACTTCTCGATTTCCACTTGCTCATGTGCATCTTTGAGGCAAAGGCTGGCTATACCGAACGCTCAATCGCTCAAATGCAAGCATTAATTGGTTTCAACCTG
AACGAAAGTGCGACGGATAAACGACCTGACACCAATAATGTCAGTCACCTTGACATGCTGCGGAGTTTTGTTTCGCGGTGGAATGACGTCGGATCAGTTA
GATTTGGCGACGAGCAATGGGGAACGAGTGCACTGAGTTGTGCATTCGAGCAGGATTCCCCCGAACTGTCAGACGCTGGGTTCGAGGAATTCATCCACAC
AAAATGCGTTACGACTATCGACCAAGTGAACCCTCCTGACGCGATACGGAGTCAAGAACACAAGCAGAGTCTTTTGTTTGCTTCTGCTGACTACCAGCGC
AAATCAAAGATAAATTCGGGAAGAGATGCGGGGGCTGGTAGCGATGTGAACACAGACCTCGCCGCTGATTTTGTTGCGTGCGATGACTCAGATACTGATT
CAAGGCGAAGTGGCACAGTTGTTTACAGTAACTTGCATGGTTATCGTATTAGCATTGATGATATGGATGACACGAAAGAGTATGAACGTATTTTATGCGA
GTTGAGAGGCACGGAAACCGCGCGAGCTCGCCAGGACCAGTTAATTGAGAAGGAGCAGGCTAAGCGTGAAATGCTGGCAGTTACGAAGGCACAATTGGAG
GATCAACGCGCAGATTTTGGGGTTATTGGAGAAGACGATCATTTCATGAAATGGCTTGTTCGCGAGGAAGTCCAAATACACGTACAATGGTCCCCACTGC
GCGCTAGTAACCCACTTCATCAGGAGCTAATTGAGCAGCAGCCAGATCGAGCCATATTGACTGATGAAATCCAGCCGTTTTTGTTTACTGTCCCAGCGCC
GTATCGATGGCGGCTTGTTGCGCAGCTTCTTCGCATATGCGGTGTTCAATGGCGTGGGGAATATCAATGGGACGATAGTCTTCAATTTTGTCAGTGGATG
TATGCAGACGATGCTGCGGATTGTGAACAACTTGTGAACCCGATTTTGTCAGCTTTCAGCCCTCGACCTACGAAACATACGTTGGTTCTTGATCCGTATG
ATCGGAAAATGATTCTCGAGACTGTCCTTCTCAACGATATTGTAGTCAAGGATGGTGTGATCCGCGATCCTAAAAAGGTGGCTTTTGTTCGTCGAATTTT
TATGCAAGCACTAAGCGTTTTCCAAACTATCGACGAGAAGTTCGGGACAACTTTAAAATGTTTGTTGATTAGTTTTGAAGCTGAGGTTACACGCGCAACC
GGTGATGATGAAGCTTTTGTGATGTACGCTCGTCGTCTGAGTCAGCAATTAGTCCAGAGGAGCGTTAATGGTGATACGGATTTTGACGTATTGTTTGCCT
ACGCCAAGTTGGAACTTAAACTTGGAAATGAACGTCAGGTGCGACGTATCTGCGATAATACGCTTGCGTCGCTCAGCGCCCCATCCCAAAGCGATGCCTC
CGTAGCCCGACATTTCCATCGCTTTGTGTTTCTTCGCGCACGGCTTGAAATGTGGCCTTTGACGAAGAATCAGAAGAAATTACCCGAAACGCTGACTTGC
AGTGAAGGACTACTTCGCGTTCTAAGATGCCTCTACACACTTTGGAGTGCGCAGCAACCGGAACAGGGTGGTGGGATTAAGAAGGAAGCGCTAGACACTA
TTGCGAAAGTGCATCGAAAGCGGATTTACACCTATCTGGAGAATATCTTAAAATCTGATCCATTGACTGAAACGAGCCTCATCGCTTGGTATCGAACTGA
GCTAAGCTTTGCGATTCGACACTGTGCAGAGTTAAGTTCGCAGCCTCACGATGCCCACTCAGCGCTTAGGAAGCCGCATGATTGCTGGGTTGGCTACTGT
TTGCACAACTTGGCCTTAGTGATTTACGCGTATCGAGGTTTTGAAGCGGCTTGCCAAGAATATCGCCAGGGTTTGACCGAAGTAAAACACCAAGCCTGCT
CACACCTAAATTGGATGTGGATCTGTTTCTTGGAGTTCATGCAGCAGCATCAAACTTTAGGTTTGTTTCCAGCGGTTGCGCCACGTGCATGGCGCGAATC
CATCGGTGACGCAGTTGAGAAGTTTCCAAGCAACGCGTTGTTTCTTCGTCTCTTTGTCGATGCTGAGACGGGTAACACGATATCTCAGGTGCTTCGGAAC
TACTTTCTTCAGGTAGAAAAACGATGGAGACGGCATTACGATTCTCCAGAATTGGTGGAGTGGTTATTTGCGCTCCTTTGTGAACTTTGCCGCGCGGAGC
GAGCCGCAATGATCAAGTGCCTAGCTGCTCCGCAGCTAGACAATGAAAATCGTTCTCGACCAATGTGCTGCCTTTTTCATCGGTGGGGCATGAATGGCAC
TGCAGTTACTCGTATCCGACAAATGTTTGAAAGTATGGTGAGCCACATCCGTACAAAGGGTAGTGCGCTCTGTTGGCGACTATATATGCGTTTCGAAATA
GCGCTCGGGAAAGTGGATGCGGCAAAGAAAATATTGTACCGTGGGATTGCCGCGTGTGCATGGAGCAAAGCGCTGTACATGGATGGCTTGCGTGTGCTGC
GAGCGTATTTGAGCGAAGATGAATGCCACGAACTTCTTGAGTTGCTGGAAGCGAAGGAGCTGAACGTACGAGTTGATTTTTGAGCGACTAAAATAGCGAT
GCCTGCAGTAAAACAACAGTATTGTCAAAGATGCAACAACGAAAACGGGGAAACGAATCGACCGGGGAAAGTCGAAAGCTTGGTCGACGGGGTAAGTACT
TGAGATAATATAGTGCCAAGCTTGAGGCGGAGTACCGATGCGTACGCTTGTTCTTTGTTGGTAGGCTTCGATTTGGTCGAGCAGCTTGCTGCCATTAATG
GCTCGGAATGGAGTGTAGCAGGTATCTTAGACGAAGTTTTGCCCGAGCAAAGAAATTTGTGGGAGGCGAGGTGCTTGCTGAGGCCCACACACTATGGAAA
TAACGTATCCGACAGCAAGAAGCCCTTGGGGGCGAGTGTTCGTAAAAAAGGCAGATGCAAGCGGGGTGGGTCTGTGGAGCCCATTCGAGCAGCTCTCAAT
CGACCCTCTACCTCAACGTTGGCCAGCCAATTCTTGCAGCAACCTCTCCTCGCCATACATGCCGATAAGTACACAAGCTTGCGCACACCAGACAACCGTT
TTCGCGGGCATCTACTTACTCTTTGGGAGGACAAATTTCGACAAAAATCTTTAGCAGTGGAAGACATTCTCTTTCTCATATCATGCCCAAATGTTGCTTC
CACACTAGAAAGCGCGAGTTTTCTACGAGCAACTCAGATGTCCTATGAGCAAGTTATGGAGCTAGAAATGGCGAGTATGATGCTTCGTGAACAACAACAG
GAATGGTTCCATTCTGCGTACACTCAAGCAACTACTACCTCACTATGCGATAAGCTCGCGCGTAACGCATGGATTCACGGTCGAGCGTTGCGGGCAGGTA
GCATCACGCTTCCGGAGGTGATTGTAAGCAAGCGTTTACCATCCCGCCCCGCATTACGGATGTCACCCGTAGGCAGACGCCTCGAGAAACCAATCGCTCT
CTCTAAGCGCCCATTACAAACGCATTCACGATACATTTCCACCGCACCGAAGCCTCTCGGTATCCAAATGCAAAGTGAGCGTCATATTGGTTCTTCCTGA
CCATGATGTTGCTGTTGCGTGTGCAAAATAGATGCTACAACTGCCTTGGCAAATGGCTGCCCGCTTAATATTCAAGATTGGATCCGTGATCACTGCATGG
AAGAAGTAGCTCGATCCACTACCATGCGAAAACGATTCGCCGCCGAAAAGCTATCAGTACGCACTCTTGCACATGTGAGCTTGCTTCTTCCTAAATTCAC
CCCTCTTTGTTGCCCAGAACATCATGTCCACATATTACCACCAAGTCACATACCGGCGATTTATGCATTGGCGTCAACAAGCATTGTGGACGCAATGCCA
CCGACAAGTCCGCAATTTTTGCCGCCTGTACGCTTTGCGTCGAAAATACTGGGACAGTTCGTTCGTAAGACTAATTTCTTGTGGACTGCTTGTGCTGATA
AGGAAATGCGCATTGTGGGTCCTCCAAAGATCGCGCACAAGACTGGAATCTTTAGTCTTTCGCTTGTGGGCGAAGTGGATGGCGGACACAGTCCATCAGC
GGGAGTACGAAGCAATCGCTGCTGCGGTATCTGTTCAATGCTGGTTTCGCGGTGTGAAAGGAAAACAAGCTGTGGCCGTCCATCACCTACACCAAGCTGC
AACAGTATTGCAGGCCCATTGGCGAGGATATCATTCAAGGAAAATGTACAAGCGAAAAAAACGCTTCTTGGCATACGATCGGGCTGCTCATAAAGTCCAG
CGCTACTACTACTCGTACACTTTCCGCGTGCGTTGTGCTTTATGGATGGTGCAACAACGAGCAGCACGCGTTATAACACGTGCTTTCAAGCATTATCTCG
AGAAAAAGCGCGACTTTATCGCTTGGTGTCATCATCTGGCTCGGTTTCACGCGGCGATTTCCATTCAAATTTGGATGCGATGAACCAAAAGAAGAATCGC
TCGCGCCAGGGCGAAGCGCGACAACCTAGCACGAGCGAGGCACGTGCTGTTCAAGTTTTTCCGCTACACTCAATTCATGCGGCGCTTTGGGTTGCGCGTG
GAGACGGTCTCAAAGCAGAGGACGGCAGCGGCTGTGCTGCTGCAGAACGCGTATCGGGCAAAGCAAGCACGGGCCAGGTTCTACGAGCTGAAGGTCCGGC
TGGAGGACCAGCGACGCCAGAAAATCTTGACGCATATGTGGAACAACGCATATGCCACAACCATCCAGAAGTGGTGGCGCAAGCTTCGCCTCAAGTTGAA
GTGGGGACAGAGTGATGGTCACTTCAATCGTACTTAGCACGGAACTCTATCTCATTTCTTTTTAGGATCTGACTCATTTAACGCACCCGTTCCCCCCTTT
GATCCGAGCGAGGCGCCATGGAGAAGAGCGAGCTGCGCGTGCGCTGGCTGGTGCTGCTGCTGTCGTGCCTGCTGATGATCGGCAACTACTACTGCTTCGA
CAACCCGGCGGCGCTCAAGAGCCAGCTGCAACAGCACTTCAGCAACATCCCCAAGGACCGCTACGAGTTCCTCTTCGTACGTTCCACGTCTCGGATCTTG
CTGCGTTCTGGCAGCAATGCCGTACATCGCCTTGCAATATAACATATAGGGATATTGATTGCATTTATCCACTAATGATTGCGCCATTGTCTTCCATGTA
GAACTTGCTGTACTCATTGTACTCGATCCCCAACATCCTGCTGCCGTTCTTCGGCGGCGTGTTGGTGGATCGGTTCGGGGCGCGGGTGATGCTATTTGCC
TTCTCGACAGCAATTTTGACTGGGCAACTCATCTTTGCCACGGGCTGCTCGCTCTCGAGCTTCAACTTGATGCTGGTGAGTTAAATGCTTGTCTTTTGTG
TTGGTGGCCTGTTGATGTTAAACGGAGCCGGCGTTTTTTCATTTGCAGTTCGGTCGGGTGGTGTTTGGATTCGGAGGAGAAAGCCTCGGTGTGGCCCAGG
GGACTCTCGTCGCCTCGTGGTTTAAGAACAGTGAACTTGCGCTCGCATTGGGCATCAACCTCAGTGTGGCGCGACTGGGAAGCGTCATTAACAACGAGCT
TAGTCCTGTTGTCGCCCATGCGTCAAGCGTGTCCACGGCGCTGTGGGTGGGAGTGATCATGTGTCTGGCGTCCACCTTCACGGTGATGCTGGTGATCCCG
ATTGACAAAAGGGCGGAGAATTTGACGAAAGAAAACCAGAAGGAGGCAGGAGCGGCTGCTGAAAGCATCCACTTTAGCGATATTAAGCATTTCCGCCCAG
CATTCTGGCTCTTGGCGTTGAGCTGCTTGGTTGTCTACGGCTGCGTGATCCCATTCAACAACGTCGCGAGCAGCCTTCTCATGGAGCGTGACTTTTTCAA
GGAGCCCCCTGAGGCGTGCCGACGATGCGGAGAAGGGCTTTACGAATTCGAGCTCGATTGCGCAGAGATTGTTCCAGGGTGCCCAAGTGTTCCTCCATAC
GGGTGGCCGCTACCATTGCTATCAGCGAACTGCACAATAAAAGAGCCGCTAGATCAGTGGAACTGCTCCACTTCCCCGCCGCTAATCGATGGAGACAAAA
TCAATTGCGACGACGAAGCGTGGAGGCTTGGGCCTTTGACACAGACGTACTGTGCCACAAAAACGGATGCGGCCCAGAAAGCTGCTACGCCGATGTCCAT
TCCGTACATCATTAGCGCCATCATATCCCCATTCCTTGGGTTCGTGGTCGACCGCATCGGTCTCCGTGCGTTTTTGGCGCTAATAGCCCCGCTCGCCCTG
ACAGCGGTCCACCTCATGCTCGGACTGACACACGTTAGTCTTTACGCACCGCTGGTGCTTCAAGGCGTTGCCTACAGTGTGTTCGCCGCAGCACTGTGGC
CCTCCGTTCCGTGTAAGTGCCTATGATTTTTGTGGATGCGCTTTACTGGCGTTCATCTTTTTAGCAACCAGAGCGCGTATGCTAACCATTTGTGTGTATG
CAGATGTGGTTGAGGCGAAGCACGTCGGAACTGCGTACGGAGCTATCACTGCGATTCAGGTGCGCACAGCAACTGCATACAACGCTAGCGTGAACGCAAG
TGCTAACCGAGTGCGTGCACTTTGCGGTATCTATCGTTACAGAATATTGGACTCGCTCTGTTTCCACTGGCCGTTGCTGCCGAGTTCAACCACGATGACC
GGTACATTCCAGGTGTGGAGTTGCTCTTCGTGTCGTTTGGCGTTCTGGGTAGCCTAGTGGGCATTGCGCTCAATGTGGTGGACTACCAGAACGGGTCCAT
CCTGAACCACACGAACGCCGCGAAGAGAAGAGTCTCGCTTATGCTGGACGAGGACGCGCTCGACAGCGAGGCACTTCTGGCGGCGGAGCACTAAACTGTG
GCTTTCAGATTGCATGTGAAGGACCAGCCTTTGTATCTTCAATGTGTTAGAGCTTCGCTGGGTTTGAATACAAGCATGGAATTATAGCGACAAGCTGTGG
CCTTAGGCTCGACGTACAGCCTTGAAGAGTTCGAGTTGAAGCTATAGCAAAGCCTCAGCCAGTGATACAGGTCAAATGGGCATGTTACCTGCTATCCTGG
ATGACATCAAATGACCAAGGTTTTTGACCCTTAAACCAACATTGAAAAAGTTTGACTAACCCTATTCGATTCGGAGTCCGACTATAATACGCGGGTTCAT
TCAAAGTTCCCCAACGAGACATCGCTACCTGCATGTGCTATGCGGTCACTGTCAGTATCACCGATTCTCGGTTTCTAGCTTCACCGAGTGTTCATGTTTG
TTGTGGTATTGACGTTTGCGCGACCCGAGACGCACACAAGTGTTTTTATGCCGCGTTTTGTGGAGGGCACGCACGTCGGAAGTGCGTAACGGAGCTGCCA
TCGAAGGCATTTCCCGTTCACAATGCTAGAGCTGGACAGGTCCGATCGACGAAAATCATGTCCGGGACATGTGCCATGCTGGCGGCGATAGCGAGTAGAG
CACCTAATTGAGGAACGACGTTCCAATTGCAGTGGCGTTTCAGGGCAAGATCACGTCGAAGTGCACGTAACCATAGTAGCGCGCGGCCGCATCTTCGCGA
GTGCGAGACCGCGTTCAGAAGCACCACAGGACCAACAGAGGACAAATACGGTTGCGAGAAATCGGTCGCAGCAGATGTGTCCCCGCTCAGAGCGCGAGGC
GAGGCACGATCTGCGCCGCGCATTTCGGGTTGTCTGTCGGGCAGACGATCGAGGAGCGATCCCGACTTTCTCTTCCGCCTCTTGTGTTGACTTTGCACGG
CAACGATGGCCGTGGCGTGGCTGGCTTTTTGAACTGACTTGCCTATACCGGTGAGCAAGTGAATCCCGGAAGTCAAATGAACGGTCACGGGGTAGTACCG
TGGCGGTGTGGCGTTGTAAACAGACCGTCTGAAACGACAGGAAGCGCCGGATCATTGGTAACGGCGGTGAGTCGGCGTGCGTTACCCGCCGTGAACGTCG
GCCTTGGGGCGGCAACCTGAACAGCTATAGGATGCTTGGTCACCAGTTATAATACTTTAAGATACATGCCTGGCCGCCGAACATGTTTCCAGGCATTAGG
AGGGATAGGCCTCTCAGTGATTTACCACAATATCGTCCTTCCTGACTTAGAATCGTGACTTGATTTCAGTATGCCGCGTGGAAAAGGGGAATTAATAATT
GACTACCCGGATGCATCAAAGGGGGAGAGTTGGCTGGCGTTTGGGCTGAGCGGATAAAAGCCCACAAACCGAAGAACAGCGAGAGGAGAAGACGACCGGA
GCGTTGACGTCGTCAGTGTCGCTCCTTCCGTCGCGCTCTCTCCGGTCCCTCGCGTTACCAGCCGCCCCCTCCTCCCGCGCGGAGAAGACCCCCCTCCCCC
CTCTCGTCCCCAGCCCTCGCCGCAGCCATGGACGCCTACGAGCAGGTCCGCATCATCGGCAAGGGCTCCTTCGGCGTCGTCACGCAGATCGTGCGCAAGT
CCGACCGCAAGGTGCGTGCTGTCAGGGAGATGGGTACATTTAGTCGAGGGGCGTGCGTACTGACTCATGTGTGCCACGTAGATGCTGGTGTGGAAGGAAG
TGAACTACGGCGCCATGAGCGAGAAGGAGAAGCAGCTCATCGTCAGCGAGGTGCGTCTGCTGCGGTCTTTAAAGCCTGAGACTGTCTATGTGGCAGGGGC
TGACGGCTGATTGCTGTGCAGGTGAACATCCTGCGCGAGCTGCGCCACCCGCACATTGTGCGCTACCTCGACCGCGTGATCGACAAGCAGGCCACCAAGA
TCTACATCGTCATGGAGTACTGCGAGGGCGGCGACCTGGGCCAGTTCATCAAGAGGAAGAAACGTGAGGGGTACGACACACCTGATGCCGATCCCGGGAG
CAGCATCTTGCTGCATTTTAGGATCATCAGGTGATTTCTGACTTTTTTTTCTTTTCGGCGTGTGGTGTGAAGGTCCTACATCGAGGAGGGCTTCATTTGG
CACATTTTCACGCACATTTTCCTGGCGCTGAAGGAGTGCCACCGTCACCGCGAAGGCAACGCCATCCGACCCATTCTTCACCGTGACATCAAGCCCGGCA
ACATTTTCCTGGACTCGAACGTACGCCCTCTATTTAACGGGAGGTTTGTTGTATGCGGTGATGTTCTGACGTATGTTTTCTGTTTTTACAGAACAATGCT
AAGCTTGGTGACTTCGGTCTTGCAAAGGAGCTTAGCAGCGAGTCTCGTTTCGCCCAGACGAACGTTGGCACGCCCTACTACATGAGTCCTGAGATGGTGA
ACGAGATGACCTACGACGACCGCTCAGACATTTGGGCTCTGGGCTGTCTCCTTTACGAAATGGCTACTCTCGGACCCCCGTTCGATGCAACCAACCAGTT
GGCTTTGGCTAAGAAGATCAATGCCGGCAAGTTCACGCGCATTCCGTCGCAGTACTCCGAGGGTCTTTTCCAGGTCATTCGGTGGATGCTGCACAGGCAA
CGTTCTCGACGACCGCGGATTGAGGACTTGGAGCGCGTCCCGCAGTTGCAACAAAGATTACGTGCGTACGCTGCTGCCAATGCCCCTCAGCCTGCTGCGG
ACCAGAACCTGCAGACGTCATACAACCAGAAGATGAAGGAGCTTTTGGGCATTGAAGAGGATCTTCGTCGCCAGGAAGCTGCCTTGATGGCCCGTGAAAA
GAAGCTGAAAGGTACGAGCAAATGTTACATTTAGAGAGACGACTAGCAACTAACGACTGTTTTTATAAACAGAGCTGGAGGTAGACTACATGCGCCGCGA
GAGTGAGCTGAAGAAGCGAGAACAAATGGTAGAAATGATGACTCGCAAGCTGTCCTACAACGCAGCAAAAGTCGGATCTCCAACCACGTCTGACGACTCT
AACTCCAGTGCAGACAACAACTTTAGCCACGGAGGCTCGCAAAGTCCCAAACGGCGGGTGGACAACAACAGTGCTGGTAGCGGCGGAAGTCCTCCGGGCC
GAAGCAGTCGTCAGCCCAACCTAGCAGATTTTCAGActcaatcgtcaggagacctgaacgcgaagattgaggaagcaccaaggtctCAGCGCGGTGGACC
TGAGTCTCAGCGCGGTGGACCTGAGTCTCAGCGCGGTGGACCAGAGTCTCAGCGCGGTGGACCTGGTTACCCTGCCAAAGGCCAGAGCAGCCCTTACTAT
GGTCCAACGGGCGATGTCAGCTCGACTCCGTCGACGGGAAACAGACTCCGTGACGCCCCCGAGCAAGTCGCCAACTTGGTAAGTAAAAAAGTGTTCTTCT
TGGCAAGTGGATGCTGTTCCAACTAATTACTTGTTTAATATGGATGCAGATGAAAGGAATGTGGAGAAAGAACAACTAGCTGGTGACGGGCGACCCCAAG
CCCAGCACGGGGAATCTGAAGCCGGCATCAGTTAAATCTAGTCTGCGAGATTGGCACGAGAGCAGGTCTGGGCAGTGGAGGGGATGCGGTGCGACAGTAA
CGTATTATCTGCATGTGTTTTGGTGTAACTAATCGACAATGAAGGCGCACACTTAGCGACAAGCTGATCAAACGCCTTTGCCGGGTCTTTCACCGCCAAG
CACGCACCGCCATGCGTCACCACTATTTGTACAAGATATTCAACCAAAACACACAAAAAAACAAGGCGCGGAATCCAGCTGCACTGCCAAAGCCATCCAC
GACGAAGAGGTTTGCAAAAGATAGAGGGTCCGACCAACGCATGATGAACCAGCTCAGACGGGAGCCATGGGGTAACTTCCGATTTCGATGGTTCAGCATG
TTGCGAAAAGACAGGTTGAGGTAGGAAGGAACCACAGTAACATCAATTTGGTAAATTCTTTCTTTATGCTCAGTTTGGGTTTCGTGGATGACTGTTGTTT
TCCTGCGAGTCTGCAGTAACTATTTCTCGTGACAGGATGACCTTGTTCCTGTAACTCGAACTATTCGTAATCGACCTGTTCCGCTTACCCAAGGGTGTAT
GCTCACTTGGCATCTTCTACTTCGGTGTTAGTGTCTTCCTCAGCTTCAGTGGTCGTCGTCTCTTTTGCCTCCACACGAATCTGCAGCAATGCTTCGACAC
GCGTCCGGCAGATTGGGCATGTACTGGAGCTCTTACGCAGCGCTTCAGCGCACTCACTGCAGAGACACATGTGTCGGCACGGCAAAATGGTAGTGTTCCG
CGGCTCACACAAGCAAATGATGCACTCGGCGCCTTCGGGAATCTCAATTTCCTCCTTGGGTGCCTGAGTTGCGTCGGCTTGACCTTCGCCCACCGCACCG
CTACGTTCAGTTTTGGGTGCTGCAGCCACCGTGCCGTCGATGCCGTAGATCTCCTGCAGCTCGTATGTTAATCCATCCACCTAGCAGACACCAGTCAGCA
CTCATTGCCTGTTGCCAGCCAAGAAGCTCGATCGTACCAGAATCTTTTGCTTGAGCATCTTGACTTCCCAAGTATCCCCACCTTTCTTGACGAACGTGCA
GAATGTTGACTGAGATTGAGGGCGTTTTCCTGGACACCACGCAACGCACAAGTTAGGGGGTCAACAGCAGAGTACGCTTCACATCGACTCCATGTGCACT
CACTGGCAGATGAAACTTCCAGCACAACGACCAATGGGAACTGCATAGCTCCGGGCTTATACACCAGCTCGTCCGGTTCGTACGACGAGAAGTCCAAGAG
CGGCAACGGCTGCTCGAGCTTCTCCTGGTCCTCCTCTTCTTTAGCCGCGTCCTCTTCGTTCGCGCCTCCCTTCAAAACGAAGGTCTGGCCCAAACCCGAA
GGGAAGTGCTGGGTCAGCACTGGGTTCTTGTCTGCATGAACCAATGCAAAGCTGGAGCTGCCAGTGTCCGCGCTAATGGTCTCCGTTGCCACCAAGAACA
CACTGATGCGGCAGGGCTTGGTAGCATCGAACTGGAACTCCAACGCGTAGTGATGTGGCTCTGTGGACGACTGCTGTAGCTTGAGGCTGGCCTTCTTCAG
GTTCACGTGGTTCTTAACTGTGCACGTTTGCTGCAGCTCCGGCACCTCGACGGGGAGACGCCCTTGGTTGGACATGAAGGCCATGTCCGGCCGCCCTCGG
CTCAGATACAGCGCCTGCATCTGCGCCGGTGTGTAGCTCCCGCGCGACGCGGCAGCCGCACCCGCCGGCTCCCCATACAACGTCCCTGTCGAGCTGCGGC
GCTGGCGATTGACGCTGGCCGTGTGCCCCATCGCGTCGAATTGCGTGTTGCTCTGCAGAGCCCACGCCAACGTATGTTGGCGGTTGAAGCCTATTATAGC
TAACGACCTCAGGTTACAAAGTCACACGCCTCAGATTAAAGGTTACGCTGCACTACCTCAGCAGCTGAGCTTCAAGCTTGAGCGGATCCAGCTGAAGCAG
CTTCTGCAATATAGTTAACCTTTGTATATTGACTCTACTCAACTGTCTTCAGACATCCCCCACGCGTTGGCGCCCTCGTCAGCGTCGGCATTCCACATGA
ACGAATTGGCTCCGTCTACAAAAGTAAAGTGGAATTAGTGAGAGTGGTAAGCAGCAGGGTACTTCTATCCAAGACGGGTTCAACGTACATTTGATGCCCT
TCGCTGGAGGACAGCCACCATGAAGACTGCTTGGGTCCAAGTCGTTCATCGGCGTCTGAGAGTAGAACAGCGACGCCGTGAGCTTCACGGGCGGCACCGC
GAGTCCCTCGGAGCACTCACCCATTCCCTCTCGCTCGATCCCAGTCACCAGACGCTCTTTCGAGTACGGGAACACTGTCTCGCCGCCTTCAGGACAGTCG
TTCAAGTACAAGAAGAGCGTCGCGAATCGATTCGGCTCGAAGTGGTGCAAGTACTTGGGTTTCTCGTAGGTAAACTGGTCGCCAGCTCGCTTGGTCCAAG
CCTCATGTACTAGGTCGAATGCTCGTGGATCACGACGCAGCACCTCAAGCAAAGCGTCGTCGTTGTCTTTGTTTTCAACAAACCACGCATGCAGCTCCTC
GGTGAGCATCTCGACAAGAAACTCGTGACTGTAGTCTTTGAGGAGGTAGTTGACCAATCGGTTCTGAAAACTCATGAAGAATGTCGGGTAGTCTTGTCCT
CCGGGCCTCACGTGTTTCGGAACAGCCGCTATATCCGTGTCCATCACCGTTTGCACTTGCGCTTTCGCCCAACGTATCCACCGGAAGTAGTGCGTGACGC
CACTCACCGGCAACTTTGGAAATGAATACTCCAATGCAGGAAGACCCACCCGTTTCTCCCACGACGCAACGATGAACGGCAGCATGTAGCCCTTGCTCTC
CAAAAGCGGACCCATGATATCGTCTGACCCCCGATCAAGATTCTCGTCAATCCAATCTCTCCACTCTAAGTCTGCGTGCTCCCAGAAGAAATCGTTAGCC
TGGGCGTCTTCCATGAAACCTTTGAGCAGGGCTTGCTGGAATACTGCTGTGCTCTGGGCATCCGGAAATAATGCTCCGTCCGGCAAGAACTCTTCAGGAA
CCACGTCGTCGCCATGCTCCAGGCGAAGCTCCTCGATTCTGGACGAGGCCCATTCAGCCCATGCCACGAACTCGCCTGCAGCCAACTGCTTAGTCGGCAC
AAACTCTTTCGAGGCAAAGTAGTCTTCGTGCTTGCGGAAGAACTGACCCGTTTCGTACCTCACGAGCTGCATCCTCTCCGTGTAGCCAGGAGACGGTAGG
CGGGCGATCCGCGCGGATCGTTCACGGAAGTCACGCGTGAAATGACTATCAGCAAGGAACGCCGTGAAGCTCGTTCGGTCCGAATGGTATCCATCTTTTG
CGTCGACACTGTCGACGGGCGAGCGAGAGAGATGGTCGATGCCCTCTGCGATAATAGCGTCCGCCTCCTCCTGCGTGAAGAAGCCTTCGACCGTGAACAC
CTTCGGACGCAGCGACTGCGTCGTGACGGTGCAGCCCTCGATCTCGCGCACATAGCCCACCTTGATCCCAGGCCACACCCATAGCTGTCCATTCAGAAGC
ACGTGCGCAATGCGCTGCGTATCCAGCTCGCTTGCCGCGAGGATTGGCAGGCCGTCGACGGAGAAGAGCCTCAGTCCATTGGCCACTCTGTCAGGGTCGG
CTCCAAGGTGCAGCGCCGCTGTTTGGGCCAGCTCGAAGAGGCACGCCTCCCCGTCCTGCTGGTGCGTCCAGGGTAGATAGACTCCCTCGTTCTGCCCATT
GAGCATGAGGAAGACTCGTGCCTGAGCTCGAAGCTGCTGCTGCTGGCCCAGCACCTGCTCCACGTGCGTCAAGCCTTCGTCCGTCGACAGGAAATCCGGG
CAGGTCCATCCCTCGGCGGCGGCGACTAGTGCCGGGTGCGTGGCGATCTTCACCACATCGCTCTGGTACTTGTCCACGAGCGGCGCGCCCTCGGGTGACG
TGGCAGGCTCCGTCGACGTCGAGACGCCGCGGTCGAGCGGCAGCCAATCGGACGGCGTCCAGACGGTCGCGAGCAGTGCCACACCCACGGCGAAGGCGAG
CGTCACGAGGTGGATCGGCAGCGTCAAGCGCGGCGGGGCTTCCTCCCCGCCACTCCGCGTCGTCGGCGTCGGTGCCATGCCACTGGCATTCGGCGTTGAC
GCAATACGTGCGTTTTGGTAACATTAGCAGAGGCGGGGCAAATGGGCTGTGGATGGACCCAATTCCCAAGCAGAAAATCGGACGTTGAAGCCGCGCAACG
CCACGACGCAAAGCGTGGCTGAAGTTCGCGGATTCGATGCACTGTTGTCGGCCGGCCATGGGGATACACTGCGTGTTCCAATGTCGGCAACGGCAAGCAC
CGGTGTATTTAATTTAATTTATCTGAGCATTGGACTCGGTCGTTTGCAGAGTCTGGAAACAAAATGGCTCCTATAAGAGAACGTGCTAAGAACTCGGTCT
GACGGGAAGTATAGTGGGTTTCATCGATTTTGCGTTCTTATGTATCGTAGTCCGAATTATATTAAGCAAATCCCATCTGACCAGAGTTAGGAGCGTAAGG
TTCAAAGGGGAGGCATTCGAGATGGCCATACCTCCCCGTCGCTAAGGATGATCTAGCCATATAAGACATCGGCCCGCTGTATGTCTTCATCTAATGGTAT
TAATACTGAGTGAGGGTGTGAGGGATGTTTTGACGCAGGTCCCTTTTGCCGGCATGACCAACTCAGAGCTGGCCAAAAACGCAAGTGTTCTGATAAGCTC
TGCAATCGAAAGGAAAACAAAAAAATCACCATTTGGGCGACAAAGACGACCCTTTTCCTCGTGAGACAGCCAATGCAGACACAGGCGCGTCATTCGACTG
TGATTGGACTGCGTCGACAACTTGACAGAAATACCTTCGTGATCCGATGCACGCTGACTTTAGATATGGACATACTCGTTTTTTTTAGTCACTCCACCCT
CTGATATACAGTATTCCTGTGTTACTGTATAGATGGATCGCTAGTTCTGGTGCAAGGACACCAATCTTGGCGCAAGGCGGCATTTCCGCTTTCGACCGCT
TGAGCAGAAGCTTCCATCCCAGCCCATCCACGCTCCAAGCCCCGCCACCATGCAGTCCGCCGTGCTGAAGACCTgccgccgcgccgccgcctcgggccgc
gtgcgctccgcccgcgcgcTGACCACGTACTCGGGCGGCCAGCCGTCCGAGGGCCAGGGCGGCTTCTACGGCTCTGCCAAGACGCGCTCCGAGGCCAGCT
CCAAGTTCAGCCCGGGCGCGCGCGCCGAGCCGCAGGACCTGACGAAGCTGCAACAGCTCATGCAGCAGTGGGAGGCACAGAAGGCCTCGCTCGCCGCCGA
GGAGCAGAAGCAGGCGCTGGCGCGGATCGCCAGCGAGGAGGAGACGCTCATCCAGCGGTTGCTCATCCGGGGCGCGCCCGTGTGGGGCCTCTCCACGCAG
CAGCGCGAGTTCGTGGCCCAGTGCAGCAAGGCCGCCCCCTAGGCGCTCTGCGTGTCCAGACCGCCGACCTCGTGCCTCTCCAGGAAGCGTCGCCTTCTTG
TCTGTATCGCTCAGTATCTTGGAGGAATAAAACGGGATACGAGCTGCCAGTTAATGTATCAGTTGATCTTCTCGATTCGTGGAGGGTGTAGATGTAGCTT
GTAAGATCTCTGCTTATGCGAACGCTGCACCACCGCGGGCATGTATCCGGCAGCGGTGCCGCACTGTTTTCGCATTCGCGCGAACTCTCAAGACGTGGAC
CAGGCGTGAGAGAGATTCGAGAGCACGATTTGAAGCACGCACCCAAGCAGCCTCGCATGAGTCATGTGGAGTGGCAGCTTCCGAGCTCGGCGTCGCGCTT
GGCGCACCTCGAGCGTAGGCTGCGGCCGAAGAGTCTCTTGGCGGAGCCAAATCCTGGTGGTACAGCAAATGAGACGTGGCGATGGCCGCGTCTCATTTTG
CTCGGCGTTTCTTCGTGCCGGGAGAATGGACCGCTAGGCGTCCACACGTGTTGCCCAGGACTGCAGTCCTGGGCAACAGCAAGTACTAGGTATAATAGCT
GGCGAGGTGTCAAACAAACTACGTACTACTAGTAGCTTGCAGAAGCATTACCACTTGAGTCTAAAACTGCGCACTCACAACATGTATTACAGTTAGCCCT
GGGAAGGCGGCGACTGTCGCTCACAGTTTCAGACTGCTAATCGACTTGACCTGACGGCCGTATGTGGGCAGGTCCAGGGTCCGCTGCCGTTGCATGTCTG
GGAGCTGTCGTACTTCGTCGTGATCGCTGTCCGCAGACGCTTCGCTCACGGTTCGCCTCAAGGCGGGCGGAGGTGCCTGCGCATCCGGTGCGCTTGACGG
GTCCAGCAGATCCGAGAGCGCTGCTGGAGCTACGTGCGCGTCCATCAGATACATCCGCAGCGTTTCCAATCTAACGGCTGGCGAGCTGAAGGCTTGCGTA
GGTGAAAGCTTGTCCCCATCCAGCTCGACGGCCGGTTCCATCGTGTCGGAATCTTGGCTGCCATCCGAGTCACGCGCGTCTTCCTCCCATTCTGTCTTTA
ATGAGATGCCCGCTCGTTCACTTGCTAATGCGCCGAGCTGTGCGACTAGTCGAGCTCGAATCTCAGGATGCAAGCCACTCTTCACGATCATCTTATGGTA
CATTCCAGCTGAGCGTGCTCCCGATACAATGGCGCTAAGCCATTCCACAATGCGCCGAAACTGGATGACGTTGTCGTGACAGACATGGTGGCGAAACAAT
TCAAACAGCTCAGGGTACTCGCCAAGTACACGGTGCTTCTGCACTGCAAGTTGCTCGACACGACGGCATAACGCGTTGGAGACTTCAAACCCGTGGATAC
CCGCGGAATAGCAACTGGAGCACAGTTCATAGTTCACGCAAGTGCTACAGCTCCACTTGCCTCCAACGATGGGACTGATTCCACAGCCGCTGCAGAGGGC
GTCTTCATGAACGTGGTTCTTGTGATAACGGGCATTGAGGCGTGTCTTGACGTCACCAAGCATACCACCCACTCCAGTTTTCGAGCGCAGTCGACTGAAT
ACTCCCCCACTTGGATTGGATCCCACAGCATGAAACGAATCGAATGGGAGAGATGCCTTTCGGCTAAACTTCTTAGAAGTACGGGACGACTCCAACATTG
ACTTGGATTCGGTCATGCTAATACTCAGGTCGATTGGATTCGATGTGAACCGGTCCTTTGACGGAACGAGTATTCGGCTGGCATGGAGTACCGAGGGACT
GGAGGCATCACTCTTGGGCCCATAGAAAAGATGGTCTTTAGCCCACGCTAATGATGAATCGGGGGCTGTTGAAGCGGCTTCATTTATTCCGTCGTCACTT
GAGGCTTCAAGACGCATTTCATCCTTGTGTTTATGATCCAGCGTGATCTTTAAATCCGATACCCGGACATATCGTGTGCGGACATACGCTTGCACTTTCA
GATCACGCCGATTCTTCAGTAGCGGAACAATCAATCGCCTCATATCACGATTAACCTCATCGCCGAGGCTTTCGATCGAGATCTCTGGGTGGAAATTTGA
GCGGATATCACGTCCTTCAAGCACGAAGCCCAGCCATTTTGAAATCTTCTCACGACCACTCTCAGGCATGTTGCGAATTAATCGTTTTACAACCTCCGAT
TCCATGTCGATTGGCGCAACGGGAAACACCTCATCATCTAATTTCCACTCACTTTGTGAGCTAGCTGAACCTGTGCTGTCTTGGCGATTAAGGGAACTCA
CACTGGAGAGCCTCGTCGTGTCTTGCGAATTTGATCTTCTATTCACCAGAGAGCTTTGACTACCACCACGGACGGAGCGTAGCATCTTGGTTTTCGTACC
CAAGTAATCCAGATGTGGCGTATGGTTTCCTGAGCTCCGCATGTGAACATCGAAATCACGGAGCTTGCGTTGTAGCACCTCGATCTGGGAATCATATTCA
ATACGACAACTCGCCAATTCTTTTGTTAGCTCATCAACACGCTGCGCGCAAATTTTCAGCTCATTAGCCTTCGCCGCCACCTGTTGCCGAAGAAGTTCAT
TTTCCAGTACCGAGATACTTGCGCGCGATCTCTCCGACACCACTGCCACAGAAGATGGAGCAGGCCGAGCAAGTTTTTCGGTATCCAATTCCATGTTTTC
CTCGATTGTAGCCTGTACAGAAACCTCACTGTCAGCAGTGCTGGCACTTGATAATGGCGGCGTCTCGACCACACTAGCCTTGGCTTGACGTCTTGCCAGC
ATGTGGTTTAGCTCTTCGCATTCCTTTGTCTTTGCCTCTAACTCGTTTTCCAAAAAAGCCACTTTCTTTAAGAAGTCTGCATTTCCACTAACAATCGAAG
CAACCTCACGCTCTTTTTCCAGGAGATTCTTGTTTTGCGCTTCGAGTTCAACACATCTGTCCTCCAGACTGGACATTTCTGCTGCCTTAGATGCCTTGTC
ATCTTCCAGCTCCTCCACTTTAGCTGCAAAACACTTCAGCTTCTCTACCGTCGTTGGCTCTGTTGGTTCGGTGGCGTCACTTTTAGCCTCGCGAAGTAAA
GCCTCCAATGATTCGATACGCTTATCCTTTTCTGCAACAAGGATTTTGAACTCTGCCACGGTTCGTTCTTCATTCACCTTCGGCTTGTTCTTGATGCTCT
TTGCGCGTGTGCCGAACCGCAAAGTGGAAACTGTCTCCTCGCTGTTGTAGCTACTAGAGCTAGCACAAACAAGTAGCGTTGTCTCGGAGTTTCCTCCAAG
CGAGTCTTGCAATAGCCTAGTTAGCTTGGAGTCGCGGTACGGGATGTGCGTGCTAGCATTGCCACTAGTCAAGGCGTTCATAACGCTTCCCAGCGCACTA
AGCGATTTGTTAATGTGCTGCGCCTCCTTGAGCGTCTGCCCTTTAGCGTGGGTCTTTCCGACCTTCTCCGATCCCGCTAAATCCACCAAGAACAGCTTCC
CACTCTTCATCGACCCGGTCGTCGTATTCCGCTGCTCAATAGTGATGATGAACACGGAGTGGCTGCGGCTCGACTCATTGTTCATCCTCGTCGAAGAAAT
CACTCTGTTGGCTCCTCCCAATCGCATGACGTCCTGCATTTCCTCCACAGAGGCGCAACAGACCTCCGTCGCGCCGGCGATCCACACGCCTCGCTCACGG
CTCTCGCGAACATTTAAGTTTGTCGACGTGGGTTTGAGCAGGTCGCGGATCTTCTCCATGTAGATCTCAACATACGAGACTCGCACGATGAACTCGAGGT
CCGACTGCATGTTCTGGATGCCGTCGAAGATGTCGGCCATGACGCGAGGGATGATCCCTTCGAAGTCGGCGTCTCCTGGCACGCCCTCCATGGAGAAGGT
CTTGCCCGAGCCCGTCTGGCCGTACACGAAGCATGTGCAGTTGTAGCCGCGCAGAGCTGACTCCACCAGCGGCTTGGCGGTCGCCTCGTACACCTCCAGC
TGCGACGACGTGGTGCCGAAGACCTGGTCGAACGTGAAGGTGTGGTCGTCCGACACGCCGCGGGCCTCGCTGTGCACGTGCGCGGCGGTGCTGTCCTCCA
GAAGCACGCACTCCACGGCCTGGTGCTTCTGCTCCAGCTTGTTCTGCGGCCGGAAGCGAGCGCACACGCGGATGCCCGCGCGAATCTCTGCGGCCGACCC
CATCGTCTCGGCGGAGGAAATCCCGAACTGCACTTGACGATTAGTTGAGGTGACGGCCATCTGATTCGGACCTGATCCTTGCCAGTCGCGACCGCTGATT
GGCATACAGCTATGCCGAAGCAGACGTCTGCTGCTACATGTAGCAGCAGGCAGTGCCCAGGCTGGGGCCCTATCGATGGCCGGAGGTGGCAGGCACTCGG
ACAAACCTGACGCCTGGTCATCATTTTTCTATACTCGTGGAGGCGATACCCGGATAGCCGATGCCAGGGTGGTTGCTTTTTTGCAGGATGCCGTGCCACC
ATAGACCGGTATGCTTACCAACGCTGCTTAACTTCGTATCGCCGTCGTTGTATAAGCTTGGGCTGGCTGGTTGTGCGCCAAGGCATAGGTTTCGAAGCAT
CGTGAAGGAGTTCCTGCATAGCTAAAGAGGACCTTCGGCGTGACCACCTCGTTTGCGACGGGCTCACAGTGCGCGGTGCTCACATTGGGCAGCTCAAGTG
ACTTAAAACGGTGGACTTGACACCACCCTGCCGTTTAGCGACGTGTTGTTCACTTCATGACCTATTTGCAACTGCAGTGCCTCAGACGTACTTGTGAGCT
TGCCCGTGCGATCCCTCTGATCTGGATAGCACCGTTGTTCAAACTCAACTTCTCTCATTTTGAACAGCAAATGGGTCCAACTCAGCGTGGTGGACCGGAG
CAACGTCAAAGTTGAATTGCACCTCAATTCGAGGACGGCAACTTCGCTTGACAATCAAATTGCCGTTTTCGACACCACCAGAACCATACGCTCTTGGTAG
CACTTTCCATCTTTGAATCAAAGTCTCCTGTGATCACTAGAAAATTAGCGCGATACTTCCCATCCCACATCTTCACCCTCGGCTCCGCAGCCTGTGTTCA
GTATGGGGCCGCGTTGGAGGGTTGAGAGCAAAAGGGGGCCTTTCGCGGCCAGCATCTTTGTGCCCGCGAATCTCGACTTTTGCGAATTCCGCGCCATAAT
TTAGAAAATGTGCGCCGACCAAACGTGGGGCTCGGCGCGAGACCACCAGCATTTGCAGCCTGGAGCAGTAGCAAACGCCCCGCCCGCCCCCCAGAAGACC
GCAAGATGATGTCCAAGCTGAGCCTCGTGCGCCAGCCGCTCGCCCGCGCGCAGTCGTCGGTGGCGGCCGCCGTGTCCAACTACCCGTCGTACGTGCTGAA
CGCGCCCGCCACGGAGGTGACGACGCTGCCCAGCGGCCTGCGCGTGGCCTCCGAGGGCTCGCACGGCGAGACGGCCACCGTCGGCGTGTGGATCGGCGCC
GGATCGCGCTACGAGACCGCGCAGAACAACGGCGCCGCGCACTTCCTGGAGCACATGGCGTTCAAGGGCACGAGCAAGCGCACGCAGCAGCAGCTGGAGC
TCGAGATCGAGAACATGGGCGGCCACCTCAACGCCTACACGAGCCGCGAGCAGACGGTGTACTACGCCAAGGTCTTCAAGAAGGACGTGCCCCGCGCCAT
GGACATCCTCAGCGACATCCTGCAGAACTCCAAGCTGGACGAGGCCGCCATCGAGCGCGAGCGCGACGTCATCCTGCGCGAGATGGAGGAGGTCAACAAG
CAGCAGGAGGAGGTCGTGTTCGACCGCCTGCACGAGACCGCCTTCATGGGCAACGGCCTCGGCCGCACCATCCTTGGCCCCATTGAGAACGTACGTGCTG
CAGGCGATCTTGTCTTAAGAGATGGATTGCCTTGGGTGCATTGACTGACTGGCTAACGCTCTTGTTGTTGCAACTTCAGATCCGTAACCTCAAGAAGTCG
GACCTGCAGGACTACATCGCCACGCACTACACCGCCCCCCGCATGGTGATTGCCGGCGCCGGTGCTGTGGACCACTCCCAGCTGGTGGAGCTGGCCCAGA
AGTCGTTCGGCGACCTGCCCACGACCCCCGCGGTGGCCCCCACGCTCGAGCCCGTGCGCTTCGTCGGCTCGGACGTGCGTGTCAAGGACGACAGCATGCC
GCTGGCCCACGTTGCCATTGCCTTCGAGGGCTTCAGCTGGACCAGCGAGCACTCGTTCCCCCTGCTGATCATGCAGACGCTGCTCGGCAGCTGGGACCGC
ACCTCGGGCGCCGGCATGAACATGTCGTCGAAGCTGGGCCAGGTGGTTGCTGAGAAGGAGCTTGCGCACTCGTACATGTCCTTCAACACGTGTTACCAGG
ACACGGGTCTGTTCGGTGTGTACGCTGTGGCGGACAAGTACAAGCTGAACGACCTGACGTGGTACACCATGGAGGCGCTGGTGCGCCTTGTGCACAAGAC
CACGGATGAGGAGGTTGAGCGCGCCAAGACGCAGCTGAAGGCCAACATGCTGATGCAGCTGGACGGTTCGTCGCCGATCTGCGAGGACATCGGTCGCCAG
ATGCTGACGTACGGCCGCCGCATGACCCCCGCCGAGATCTTCGCGCGCATCGACGCCGTGGACGCCGCCGCTGTCCGCAAGACGGCTGACGAGGTCATCA
ACGACAAGGAGCACGCCCTGGCTGCCACTGGCCCTATCCACGAGCTGCCGGACTACAACTTCATCCGTCGTCGCTCGTACTGGCTGCGATACTAAGCGGG
TCGTGTCGTCCCTACATCCCAACATTGTCAAGAAGGGAGAATGAGGCATAGAGGCTGAGAGAGATAAGCAGAGTTGAGTTTTCTGTAGGGAAAGCGGACG
GGCCGGACGCCACTTTGCCACAGGGGAAAAACACGAACGAATGGAAAGAAAAATGAATCGACTACATAACGCAACGTGTTCATGTCATCGCAATTTGCTG
TCATTTATCGATGATAAATCGCCGAGTTCGATGCAGTAAGCCTGACGTGGTGAACATTTTCCCAGAAGCTGTGATTTGTGCGCGAGTTGAAGTAATACCA
AGCCCCGAATCCCGCATCGAAAACTTTTTCGAGGTTGCCAAGCTTGAGATCTTTCAAGAAAACGCGCAAAGCTCGTTGGCGAAACATTGTCTGGATAGTC
TTCGCGGCTGCATCGACAACGGGATCACTGAGTGTTCTGCAGTTAATTGAATTTGGTGTTGGCATAAGTTTGGCGCCAAGGGAATAGTGGTAACGACGCA
ATAATCTTGGAGCTTCCCACTGACTCAGCCGGGTGGTGCGGTTGTAGTAGAAGTACTGGTTGTTGCAAGGATTGAGCACCCGCTGATACGTTTCGGTCAG
CAGATCAGCGAGACAACCACGCGCTCGAAATGCTCGGAAAGCAGACTGAATCACAAGTGCAGCTGACGCTGTTCGACTCTTCGATGCTGAAATACCTGTG
ATTGCTTTCTTCTGCCGACTCGAATCTAGCGCTGGTGACAGGAGCTTGTCGGGATGCTTCGTCACGGACTCATTTTGCTGAGGCCCTTTTTCATTGGAAA
AATCGCTGGAACTAGGCTTACCTCCCAGTGTTGCGATTCGCTCTCGCACTTGCGCAAGCTTCTCTTTGTTGATATTGACCTTACGGTCTAACACGCGGAG
CTTGTAATGAATCTGATTTCGAGGCGAGTTACTGTCACCGGGGTACCACACGAGAGTTTCTCGCGGTGCTCGCTGACGAAGGAAAGATGCGCAACGCTCA
TCAGAGTCGATTTCTGCCAGTAGTATTGTTTCGGTAGCTTGAAACGTGGCAATACTAGCGTTGGTGGACGATGCTAATCGTTGTGTTTTAGGGAGAATCT
CCAACGCATCTCTTGGCGTTCTTATAGTCCCATTCCACGTCATTCGCGCCCGCAATGGTGGACTTTGACTTTGTGGAGGTGATGCACTGGGTTTAATTAT
CAATGGTGGAAGTGCTATCTCGTCAGCCGCACAGACCCAACGTTTTGCAGTATTTCGTTTTTTTCTGTCAACGAGGGAATCGTGTGACATATGATCTGTT
TGATTGTCATCATTGGCCCCAGCACTGTTCAAATGAAGTACAGGAAGTGATACGCGGTCACTGCAGAGCCCACCAGTTGAAAAATCACAGTTCGAAAACG
ACTGTCGAATACGGCATTCGACAGCCTCGTGTCTGGTGTTACCAAAATCTTTGCTGCTGTCACCAGTATGACCACCACACAGACGAGTGGGATCTGCGTC
AGGTTGCAACTTGGACCGCGTGCCAAGCTGCGAATCCATCGTAACGCTGGAAACTACGCTTTCGAACGATGGGCATCCCGATCCCATGATTCGGAGAAAG
CAGCCAATTTTAGTTGTCAGCCACGCTGCAGGGTGGAGCTTCAAATAGGTACTGCAGACGCCCAACTACGGACAACCGCATTCCTGAACTGGTTCTACTA
TGGCCATGGACGAATTTGGTCGCGAGCATTACGTCGCGGAAGCTCCTGCTGGTCGGCTGGGCATCTTGCTCGCTGAAAATGAACGTGGCTTCGTTGTCGT
TCAAGGGTTTGGAGAAATTCCGACCGATGAGACCAATAAACAACGACTGGAAACGATGCGACAAATAGTTCGTTCAGGGGATCGGCTTATAGCAATCGAT
GGCGACGAAGTTGTTCACTCAAGTCTATCACAAGTCATCGCTCGCCTGGGAAAGCTTTCAGCGAAGAAGCGACAACTGACGTTCGCACGGTATCATCCAC
CACAACGCCCTACCAAAACCTACGACCCCGAAAAATTGGTTGTTGTTCGTGCTCCTAGCGGCCCGCTGGGCTTGATCCTGAGCGATGTTTTACACTACGG
TGCAGTCATCGAAGGTTTCCAACAACTTCCTGATGGATCGGCTAGTCATTTCAAAAAGTACCTAAACGTTCACCGCGGGTGTCAGATTGTCGATATCAAC
GGCGTAGACGTGTCTGGGCTACCACGAGAAGAAGTTACGAATGTGCTGATTGAAATGAGAGAACAAGAGAAAGAAATCATCCTGTATCGCATGACTCCTG
GCACCTGTGCTCGATTCTCACAACTCATAGTCTTACCAGAGCACAAACGTCTCAATATCACTGAAACTGAGCATTACCGCTGTGTGGTGGCTACTGGTGT
TGGTACAGAAGTTGTGGAAGGTGACATCTTAATGGGTATCAACAACACGGACATCACGACCATGAGTCGAGCTGTCGCCATGGAGTTGCTGAATCAAACG
CCACACCCACAGACGCTTACTTTTTACCGCCAGGAACCAACAATTCTGCCGGAATGCCACACAATGCAGATTGAGGCGGGGCCTTCTGGCTTGAATCTGG
ATAGTAGTGATCCTGCACACGCTAGGATTACGGGGTTCACTACACCAGAAGATGCTGATCGGCCAACATGCAGGAACTTGAAAGATTTCGTCCCTGGTAG
CTACATTATCGGCGTTAATGGGCTCGACGTGCACCAACATTCGCTTGCAGATATCTCCAAGCTGTTTTTAAAGTTAAGGAACACTTCCAAGGAGATCGTG
GTGGGAAACACGCCTTTGATGAATCGTCTAGAAAACACGCGGTCGACGGCAACAATCAGCGTACCTCCTGGACCATTGGGTATTGTATTCGATAGCGGCC
ATGACGATGTAGCTCGCGTGGCAGGATTCAATCCGATGGCAAATGGAACCCCAGGAGCTATTGAGCAAAGCGGCCAAGTTCCAGTTGGATCGAGACTACA
AACCATCAACAAGATGAACGTGACATGTTTGACTCTGAACCAGACTGTCGATTTGCTGCAGAAGCTGTCCTCGTCGCCAAAAGAACTGGAGTTTGCAACA
CGCACCAAAGCCGGCGAGTGCAACCTTCGTACAGTGAGTATTCGGGTCCCACCTGGTCCTTTAGGCATCGATTTGCGTACAACCGTATCCAACGCGGCAG
CCGTTGATCGCTTGAACGAGGACCCCGCCTGCGGTCCCACACATATTTTCACTCACGGTGGTGTGGTCAGTGGATCCGAAATACTTGCCATCGACGGCTT
CGACGTCAGTTCACTGCAGATCTCGGAACTTAGCCAGCTGCTGCGACTGCTTGCACCACACGAAAAGATCATCACCTTTGGAACGACGGTTGACGCGTAT
AATAGCATGCTCAACCCTGCAGACAAGCCTGCGCTGAAGAGCTTAATTGTCTCGAAATCTCCTATGGGCATAGAGTTTGATAGCTCACTCGAAAATGCTG
CTTGCACAACAAATGTGGCCAAGAGTGATTCCAACGAAGAGATTCCAGTCGGCAGTCGTCTCATCGCTATTGATAACGTCGACATCAGAGCGCTGTCGCT
GAGTGAGGTGGTCGAGATACTTAAAGCTTTGGCTGGGCTCCACAAGACGCTCACTTTCGACACTGAATATCGCCAGGTTGCAGCTGCATTCTCCACGATA
TCAGCCCCCAGGTCGCCCATTTTGAAAAAGATACTGAAAGGCGCTTCAGCAGCTGACGCCATCTCCACAGTGTTGCCACAGCAACCTTCCTCCTCACCCA
CCACTACCACTGCATCGCCCACAAAATCAACAGTTCGTTTTGCCGGAGTGGAGCCTTTGCAAGAAACCCCGAACCTTCCAACCAAAGTACGTGCGTGTAC
GCACGCACCTGCATTATATAGTCGAATGCTAAACTTTACTGTCATCGTAGGCATCCCAGTCACGTCCGCCGCCGTTGAATATAGATCCTCCGTCAGCTCC
GCTCTCCGCGCTCTCCATTCGCACAGCAGAAGTGACCAAAACTGCGACTCAAGTGGGACCATCCAACAACCCAAAGCAGGAGCCCGCCTTGAACTCACCG
AAAACGCAGTTTATGATCAGCATGGTGAGTTGGTTGGGTTATATACTGCCACTTATCGCTTTCGACCCTCACCGCTCTAACGCTTGCATTGCATCTTTGC
CAGGCATCGTGGTCAGGCTCCCGTGAATCAAGCCGTCTGGTGGTCGACAAGTCTGATAAGCGTCTCCATATCATGCCCCTGAACCCCTCCTCTCCACGCT
CAGCCAAGACGGCGGAAATTGCTTTTGCCGACATCTCGTCCCTGGATACTGGGAAGGCCAGCCCGCCCCCGTCGCCATCCAAGAGGGGTCTGTTTCGGTC
GCACTCGTCAAAGAAGGACATGGCGGAGCGCTATGCCGTCGTCATCTCGGCCGTGGAGACCAGCCAGAGCAGCGGCAAGAAGAAGACCAAAGTCTGGGAG
TTCGACATGCTCTCCAGCGCCGAGCGCGACGAGCTCGAAGCGATTCTATTGAACTGATCGGTCACTTTCGATTTTCTATAGCCTCTTTATACTGACCAGA
CGTTAGTAAAACACGGATAAATGCGGTATTTTACCTCAAGTTAGTAGTATTTTGTTGCGTCGGTTAATCCAGTCCAGCGTGAGTGGAAGCGGACGTCATG
GCTGGCGAGGCCGCGTGCGTTTTCGAGGGAGACTCGTCCGGCCAGGACACCCCCATGGGGTTCCAAGACACACCAGGGCAATGGTACACCGCCAACCACC
GCAAGCGCGCTGCGCTGTCGCAACTGGAGGGGGAACCGACGCAACGGGATAGTCAGGCAACGCAGGCGGCGACGGAGGTGGCAACGGAAGTGGTGACGCA
GCCCGGAGAGGGCTTTGCGCCAACGTTTGTTGCGGCTACGCCGTCTCAAGAGGATAGCGATCGTGACACCCAGCATGACGAAGACGATGTGGACGAGGAG
GAAACCCAGATCCGCATGACCAACTCCGAGGAACAGGACGGTAAGGAGAGCTGCGTGTGTGTGGAGGAAATTGAATGACAGAAGACGACTAAAGTCATGA
ATTTAATGCAGCTCCGAAGCTAGAACGCAAGATTTTCGAGGAGGCAGTACCGCTTCCGATCGCGTCGATAGCAAGTGAAACCAGTCGATCTGTTGGGGCG
ATGGGGATCAGCGACGACGACGCAGACTCCGATATGTCGGATGACATGCTGGAGCAGGACGGTTCTATCGGCGGACTGTCTTCTATTGCTGCCTCATTCC
AGCAACGGGATGTGGACCATGAAGTTGTGAGGAAGAAGATTTACAAGCCCCGCACTCCCTTTCGGGCATCTCCAGCTATTTCAACTCGGAGTCTCTCAGA
CAGCAGCAGTGGCGATGAAACAGAGATTGAAGGTGAGCCGAAGGAAGAATCACCCGCAAAATGCTTGAAGAGTGATGGCCGGGTAGCAGCAAAGAGTGCA
TTGCAATTGCGATTAGTTAAGAGTGCAAGCTACACGAAGGCAATTGCAACAGAGAGCCCATCTACTACACCGGGAGTGAAGAGTATGCGACGTTCTCTAT
CAACCCCGGAAAGAGCATCAAAGCTGGGTTTATCCGTTCGGAACTCTAAGCGAGATCACACCGAGGCAAGTCCGGATAGTGACCACGTGAAGTCGAAACG
ATCTCGGCAAAGCGAGGCTACAGTGGAGATTGATCAAGAAGTTCAAGAGCAGGAAGCAGCAACGAACCGTGGCTCGAAAGTTGCTGAAGATGCCGTGGAG
GAAGGCGAAGACGCTGCTGCCACAGATGATGCTCCTTCGTCACACTCGACGTCGCGGCACAAGGCATCTTCATCGAGTCGAAGTCGCAAGCGCGTGGCAA
GCAGTCGATCCACCACAGATAGCGAGTCGGTGGAGTCACAAGCGGAAGGTGGTTCCATTCGCGTTATTTTGACGGGGCTGGAGCCCACCGCTGCAATCCG
CAAGAAGATCAAAGCTATCACCGGCGCAGTCTACGAGAGCAACATCGAGAGCGCCACCCATGTAATCGCTCCTCAGAACCAGCTGAAGCGCACGGTGAAA
CTGCTGTGCGGCATTTCGTGCTGCACGCATATTCTGGGCGAACGCTGGTTGAACGAGTCGGCGCGAGTGGGTGCGGCGGTCGATGAGCAAGCGAACTGCC
TGCGCAACGTGGACGCGGAAAGCAAGTGGCAGTTTGATCTGAGAAGCATCATGTATGGCGTGCCCGCAGAGCAGCGCCAGCGCCTTTTTGCTGGGCACAG
CGTGTTTATCACGAACCACAAGTCTGTGCTGCCGCCGGTGAAGGATCTCGTGAAAATTGTGGAGTGTGCCGGAGGCAAAGCGTCGTCCAAAGGGAAGCCC
GGGCCAAAGGACCTGGTGATCACGAGCGAGGCGGCGATGGCCGTGGCGGCGGTGCGCAAGCAGCTCGCGAGCGCGGATCCGGAGCGGATCTACTCCCCCG
AACTGATTCTGAGCGGGATCCTGCAGCAGCGCATCGACCTTGACAAGAACCGCCTGGAACGCCCTGCGATCGGCAAGACATGGGCCACCAAGCGCCGGAA
ATAACGGCAGGCGGCCTGAACGGAACGTGTGCATGTACGCGTTGGCGGATTGCTTGTTTATTACTAATAAGTTTGAAGTTCCTCATGCAACTGCACTTTC
ACCAAGTGATGCACGAAATAATTAAAAGCTACTGGTACAGGGGCTGGTGCGTGCTGGGCGCTCGCCTACTTGGCGGTCTGGCGGAGCCCAATGAGGGCGC
AGCCTAGCAACGAGACGACGCACATGGATAGCAGGTGCTGGCGCGCTATGGCCTCTTCGATCCACTTGTCCAGGCTGCTGCTGCGTTGACGCGTCAGGCG
CCCGAGTGTGACCTCGATGGGGACGTCGCAGTAGCACACGGGCGCGTCCTTGGGGCAAAACTCCCGCTCCAGCACTAGGTGCTGGCCGCGCTGGTCAGCG
AATGAGAGCGTCTTCTTGGGCTCTGCCGAGTAACTGACCGTGATCATCTTGGTCGCCGACAGCTCGTCCAGGCGAGAGCCGCGCGCGGCGCCGCCGCAGG
AGAAGGCGCTTTCCTTGCGCAGGCAGGAGCGCTTGCGCTGCGTGCGCGGCTGCGGGGGCAGGTAGTGGTGGCGGCGGTGGCCGCTTCCGTATGGATACTT
CTGGCCTATGGTCATGGGCTGCTGCATCTGCAGCGAGCGCGTGCACGCACTGGAGCTCGAGCACGACGAGGTCATCTGTGGCTTTGCTGGCAAAATCGCA
AATGAGCTTGACTTGCACTTTTTCCTGGCCCTGTGACGACGGCAACGTCGCCCCTGGCGTTTCGCATTTGAGTTGGGTGGAGAGTAGAAAGCACTATATT
CCTCATTGAGGTTCTCAGAATTTGCTCATAATGGCCAATTTATGAGACCGTTGAGCGTGGCTCCAGCTTGGAGCGTCCAAGTAGCTACCGGTATGTGCTT
GTAAGACTATCACAATTGAGGTATGACAAGAGCGCTCACGGCAAAATTGTGAGGCCAAAAGCATGAGCGTATCGAACATGCACACATTCTAAATATTTCT
TTAAGAAGAAGACTATTCGTGAGAATAGATAGCGAGAAAGATGAAATCAATATGATGCCGCCGTGCGACCCGCAAGAATACAACGGGGAAGAGGTAATCA
ATGTGATGCCGCCGTACGATCCGCAACCGTGTAGGCGTGCAAGTGGAGCTGGCGCAGAATTTGAAACCACTGCTCCACCGCAAAATGTTACAACGCCTTG
TAGTTTTTATAGCAAAACTGCATTTATTGTAGTTTTTGACCTAAGATACCAGTTAAATAAGCCACTGTATTGCACCTGCCACAGTGGTTTCGCCGCACAA
CTAAAAGAAGGATAAATTGCAATTGCGATTGGATTAACCAACATGGTGGGCATAACTCGATTATGAGGAGTTATTCCTCCTATTTGAGGTATACCTCGTT
CAAACGGCAACCAAGGAATAGACGGGCCATTACAAAATAGACGAGACCTCGCATGCTCATCGCAAAATGGGTCCCCGTCATCAAAATACATGTAGGACTT
CGAATGAGTGCGCGTGAATGGGTAGCATGTTGAAGCAGCACAGGTAGGCTTTTTCGGGCTCGCTACGCGGGCGACAGACTGTAGGGTGAAGTACAGCTCT
GAGCTCGCTCAAATGACCAGTCGACTGCTCTCCCGTTGAAACAAGTGCAGCGGCGCGCAAAGCCACGTCGTGCAGAACACTACGATTGCACACAGTCCGG
CCTGCTCCTTATGCACTATTATTCGTAGTATTTTCAGTAAGCTGGGGTATTGACCGTAGTGTGTGGCCACTGGCGTGGCCACACACTACACTACTGTACG
ACCGTGCATTATTGGAGGCACTACGGCGAAGGGAGAAAGCGACTGGAGCGTGGCCCAGCACAAGAGCACCTAGCGCGGCGAGGCACCAACAACTGTCAAG
GATGGTCAACTGGAGGCGTTTGCGTTCGGGAGTCCCGAATCGGGACACGCCGAACGCAAACGGCGTCAATCTCCCCCGTGTACTTCAGTGCGGGGAGTGG
CCCAATACTGGCAGGCAGGAGGTGGATTTTTGCGCGGCGGTGACTGCAAATGGGCACATCGGACGATCCCATTTGTGTGGCGCACGCGGGTGTCGGCGGT
ACAAGAGATGAAAAACATGCGGAGCGAGCCGTATCTTTGCCCGACTTGAAGCTTTCGTCTGCATACTTTAATCCAGTGAGCGCTGCGGGCGTCACCTGAG
CCCATGCCATGATGCCAGCCGAGCGGCGATGGCTCCGCAGGCGCCGACGCCTTCTACCGCAGACCCAGGCATGGTGTAGTAGCTCCTGGCAACAGTGCCG
CTTCCCGCAGCGTCTCCATGGCGGGTTTTCGGCGATCGCTTCTCGCCACCCGCCCCCAAGCTGCGTTCGCCGCGTCGAGACCGCTTGTCGCGTGGGCCGA
GCTATGTGCTCGGGCGTATCAGCTCATACTCTGCTTGGTTGGGAGGCGCCAGGCCCGGCGGATGCAGAGCAGGCGCTTGATTCAAGGGAGCCGTTGTTGG
ATAACGGAGTTGCGAGTGGCAATGCCCTGGTGGCAGGAACTCCCCGAGGAAGCGCCTGCGAGAATGCACAGCTCGGCTCGCGCGAACCGGCCAAGTTTAG
CATGCAAGGCCGTCCGCGTGGGTTTCAGAACACTGCAGCAGGCAAAAAGGAGCTGCTGCCACGTGCACTGTGTTCGTTTTCGCCGCCGGGGTGTGGACCG
CTTATCTTTGATGTGATCAAGACGCGGTACACATTGCGGCGGGCACGGTTAAGTATTCTAAAGCGCGAGGGACTTGGATACTATTCAGTCGATCTGGTTT
GCGTTATCTAGCTATAAATGCAGCTCGGGCTTTGAGCCTCGACATCTACCTGCGCCGCCGATTGGCGCCACCGGTTTGCTCAATGCGGTTCTTGTCAAAA
TCGATGTGCTGTTGCAAGATGCTGCTCAAAATGAGCTCGGGCGAGTAGATGCGCTGCGGCTTCGCCTGCGTGAGCGCCTTCCGAACCGAGGCCGTTCCTA
GCGCGGTCTCGCTCGTGATCACCACGTCGTTTGGGCCAGCGCTGCCTTTGGTTACCGCCGTGCCGCCAGCGCACTCCACGATCTTCACCAGGTCCTTCAC
CGGCGGCAGAACGGACTTGTGGTTGGTGATGAACACGTTGTGGCCGGCAAAAAGTTGCCGTCGCTGCTCCGGTGTGAAGTCGTACATGGTCTTTCGCAAG
TCGAACTGCCACTTGGCTTCAGCCTTCGTATCCTTCAAGCAGTGCGCTCGCTCATATATAGGGGCGCCCACGCGTGCCGACTCGTCAAGCCATCGCACGT
CCAGGACGTGGGCGCACCGCGAGATCCCACACAGCAGCTTTACAGTTCGTTTCAACTGGTTCTTGGGGGCGAGAACGTGGGTCGCTTTCTCGATGTCTTC
TTCATAAAAAGTGTTCGAGATAGAATCAATCTTTTTTCGGATGGAAGCTGTGGGCTCGATACCCGTCAGTATAATCCGCACTACTTGAGCTTTTTGCTCG
GCATCAACCTGTGCTTCACTGCCGGGCAACTGAGTAGCGTCAATTTCGCTCATAGATTCATCCGTCGGAATGCTTGGGCTTGGTTGAGTTGGTATCAAGT
CAGTGTCGTTGGGGTCGTCTGATTTCCTCATGAGCCATCTTCTCTTCGGAGTTTTCACGGGTGGCGTAGCAATGTCAGCGAACTTGCTGTCCTTTGCCGC
CAGGCCCGTGCGCGACGCCTCCTTGGATTTGTCGGATAATCGTCTGGATTTCTTTTTAGCCGGAGGTGCAGTAGCTGGTTCCTCCTCCATGTGTGTTGCT
GTTCTCTT