Description :
From Genome Similarity Track
Location :
Scaffold_1:1325697- 1334096
Transcript NameFunction/comments
Phyin_T30-4PITG_00206Putative uncharacterized protein
Phyin_T30-4PITG_00207Putative uncharacterized protein
Phyin_T30-4PITG_00208Protein kinase%2C putative
Phyin_T30-4PITG_00209Major Facilitator Superfamily (MFS)

Sequence
8399 bases(100 bases per row)
CCTGATTGGACGCCGTTGAAGTTGATCCTCGATTCGCGTCATGACCACCAGCCCCGAACCGGAGGCTACGCCGACGAAGAGGGCGGCACGCTCGTCGCTT
TTGACTCTTGTGGTGATCTCCGCGCTCCCCGTCATCGTGGCACTATTTGTGACGGTTTGGGCGTCACCTTATTGGCTGTTACAGTGGCGTAACGTATCGT
TGTCTACGAATGTGACTACACAGTCGCCTGCGGACGACGTGCTTCTGGACAAGTACGCAAGTGACTTGGTGAAGATCGCCTATCACCCTCTATTGGTAAG
TGCAGCTGGGGAAGAAGTCCAATGTCCGGACTTTCAGCCGGTAGATGAGGAGTTAACGCACGTGGAGCTGGCGTTGGACCGAGAGGAGCAACTACGAGAT
CAGGACCGCGTCTTTATCATGCTTAACGGGCAGAACGAGGGGATTTACTTGCCCTGGATATATCATCCCAGCGAAGACGCGTGTCTCTTGGAGCTTGCAC
AGACTGCAGCCTTGGGTCTCGGCGCGGATCCGGACCGGGTGGCCAATGGTTTAAAGCTCTTTTCCATCGATGGTTTGCCCATCATGACAACAGAAGAGCT
CCATTTGCATCGTATTGCTCATGTACTGCTAGATGGGCAGCTGTGGGTCTGGCCAGGCGTTAAGGTGGCCTACGTTCGGGAGGTCGACGGCTGCACAGTT
ACGACACGGTCGCTTCATCCCAAGGTATTCACAGTAGAAGGCTTCTTCTCACAGGAGGAAGCAGATGCCATTATTGCTGAGGGTGTCGACCACCTCTCTC
GCTCTCCTGTCGATAGTTCCGAAACAGAGGACGGATACCACGCTGACCGGACGAGCTACACGGCGTTCCTAGACGACAGCCACTTCACACGCGATTTCCG
CGTACGATCTTCACGTCTTGCTCGACTGCCATCTCCTAGTTACACCGAGAACATGCAGCTTGTGCGGTACGAAACGGGGCAATTTTATCGCAACCACGAG
GATTACTTTGAGTCGAAAGAGTTCGTTCCGAACATAGCGTTGAGTGCTAACCAGTTTGAGGCGTGGATCGAATGGGCCTCGTCCAAAATCGAAGAACTTT
GCCGAAAGCATGGTGACAATATCGTTCCTGCTGTGTTCCAACCTGGAGGTGCGATGTTTTTCCCGACGTTCAAAGCACAACAACGTTTCAAAATGCACTG
CTGAAAAGCTTCATGGAAGATGCTGAGGCTGATAATTTCTTCTGGAAACACGCCGACTTGGAGTGGAGTGAATGGATTAACGAGAATCTTAAACGGGGAG
CAAATAATATGATGATTCCGCTGCTGGAAGACAAAAGTTACATGCTGCCATACATTGTGGCATCATGGGAGAAACGTGCTCAACGTCCCGAACTTGTTTA
TCAATTTCCCAAACCTCCGATAAGTGGCATTTCGCAATACTTTAGATGGATACGTTGGGCAAAGGAAAGAGTACAGTTGCTAATGGATACGCAGCTTGAA
GCTGTACCGAAATGTGTGAGACCCGAAGGGCAAGACTACCCAACATTTTACATGAGTTTTCAGACACGTTTGGTAAACTATCTCCTCGAAGACTACAGTC
AGGAATTCCTACTTGAAACAATTACCGAGGATCTGTACAAGTGGCTGGTTGAAAACAAGAATAACGATGATACGTTGCTGGAAGTGCTGCGTAATAGTCA
AGCTGCGTTCGATCTCGTGGTGAAGTCGTGGGTCAAGCGTGCTGGTGATTTATTTACCTACGAGAAACCCAAGTATCTGTACCACTTTGAGCCGAATCGT
TTCGTGACGCTCTTCTTGTATCTCAACGACTGTCCTGAAGGCGGTGAGACGATCTTCCCGTACTCGAACGAGCGTCTAGTGACTGGAATCGAGCGAGAGG
GAATGGACGAGTGCTCCGATGGACTCGCTGTGCCACCTGTGAAGCTTACAGCGTCATTATTTTACGCGCAAACGCCCATGAACGGCTTGGACCCGTCCAG
TCTTCATGGAGGTTGTCCGCCAGCTAAGGGCATTAAATGTACGTTCGTCTGTTATAGTCCGAGGACTTTGACTAACAAAACTAAATTTGCTATATCTGTC
ATTGTAGTCGGCGCCAACTCGTTCATGTGGAATGGCGACGCTGACGAGGGCGCCAATGCTTGGGGCCTGTCTGAAGACATTAAAGCGAGAGGGAACCCTG
TAATCCTCGTCTAACAAAAAGCTCAAAAAGAATTTCTAGTCTCTATAAAAAGCTACCATTGCATTATCGCCAAGGCAATAAAGCAGGATGGGGCACACGG
CCAGCGTGAATCGGCAGCGACGTGTCTCGACGGGCACACTGTATGGAGAGCCCGCGGGTGCGGCTACAGCACCGCGTGGGAGCTACACGCCAGCGCAGAT
GCAGGCGCTGTATCTCAGTCGAGGTCGGCCGGATATGGCGTTCATGTCCAACCAGGGTCGCGTCCCCGTTGACGTCCCAGAGCTGCAGCAAACGTGCACG
GTGAAGAATCCCGTAAACCTCAAGAAGGCCAGTCTCAAGCTGCTGCGGTCGCCGACGGAGCCGCAGCAGTACGCGCTCGAATTCCAGCTCGATGCCACCA
AACGGTGCCTGATCAGTGTGTATTTGGTGGCTACGGAGACTATCGACGCTGATAGTGGCGGGTCCAGCTTCGCGCTGGTGCATTCAGACAAGAACCCGGT
GCTAAGCCAGCACTTCCCTTCCGGATTGGGACAGGTATTTGTTCTTAAAGGAAGCGAGAAGGAAGAGAACACAGTAAAGGAGGAGGAGCAAGAGAAGCCG
GAGCAACCTTTGCCACTTCTTGACTTCTCATCGTACGACCCGGATGAGTTCGTATACAAACCCGGCACAGCACAGTTCCCATTAATAATTGTCCTCGAAG
TTGCTTCGGACAGTAAGTGTAATAGCACGACTTCACCGATGTTCTTGATGCTTACGACTTGCTTTGCCATTGACAGAGAAGCGCCCGCAATCTCAAACGA
CGTTCTGTACGTTCGTCAAGAAAGGAGAAGATTCGTGGGATGTCAAGATGCTCAAACAGAAAATCCTGGTACGAAAATCACTTGTCTTCCCACTTTAGAA
ATGCTCCTCACGTTTGTTGAATCTCGCTCCAGGTGGACGGATTGACGTACGAGTTGCAAGAGATCTATGGCATCGACGGATCTGTGGCTGCCGCACCGAA
AACTGAGCGCAACGGTGCATCAGGAGATGGCCAAAGCGACACCACCCAGGCTGCGAAAGAAGAGATCGACATTCCTGAAGGTGCCGAGTGCATTATCTGC
CTGTGTGAACCGCGCAATACCACAATTCTGCCATGTCGACACATGTGTCTCTGCACCGAGTGTGCTGAGGCATTGCGTCGGAGCTCCAGTACGTGCCCAA
TCTGCCGAACTCGCGTTGAAGCTTTGCTCCAGATTCGAATCGAGGCTAAAGAGACCACAACGACCGAAGCTGAAGAAGAGAAGACCGAGGTAGAGGACAC
CACGTAAGTGCTAGGTAAACTACGGAATTTCTAAGACGCATGCAACATCTTGATCGAAAGAATTTATCAAATTACTGCTTCCTTCCTACGTCCTTTCGCA
GTGTAGTGGACCACCGGAATCAAAAGTTACCCCTCGGCTTTCGTTCCAGCCAGCCCATTACACCTATTGATCGGATTCTCTATCTGGTGTAGACCTCGTC
TTTGTTGGAGACACGTTTTGCCGCTTCACAGTCCGACAACTGGGTTCCGCGCCCTTGGTTTTTTTTTTTCTTGGTGTGTTTTTTAGTTGATTATCTTGTA
CAAATACTCATAGCGCCCGACGGTGCGTGTTTGGTGGTGAAAAGACTCGACATAAGGCGTTGTTCGCTAAGTTTTGCGCCCTTCATTGTCGATTAGTTAC
ACCAAAACACATGCAGATAATACGTTACTGTCGCACCGCATCCCCTCCGCTGCCCTGATCTGTGCTCGTGCTTCGTCTCGCAGACTAGATCAAACTCATG
CCATGCCTTCAGGCCCTGTGGCTGTCGACATCAGCTAATTGTTCTTCCTCCACATTCCCTTCATCTGCAAGACGATTAAAAAAGAAAAGAAAAAACAAAG
TCAATTTAAAGAAATCAATACCAAGCTGTTCTCTCACCCTAACGCCCGACCTTCCTTACAGAGAGATGACTTACCAAGTTGGCGACTTGTTCGGGGGCAT
CACGGAGTCGGTTTGACGTCGACGGAGTCGAGCTGACATCGCCCGTTGGGCCATAGTAAGGGCTGCTCTGGCCTTTGGCAGGATAGCCCCGCTGAGATCT
TGTCTGCGGAACCTCCTCTGCTGCGACTTTCGCATTCAAATCATTACGCGGAGGACTGCCGGCGTTATTGTCTCCCCGTAGCGAGCCTTGGTGATTGAAG
CTGTTGTCTGCACTGGAATTTGAGTCATCGGACGTGGTAGGGGATCCGACTTTACCGGCGTTGTATGACAACTTGCGCGTCATCATCTCGACCATTTGCT
CCCTCTTCTTCAGCTCACTTTCGCGACGCATGTAGTCCACTTCGAGCTCTGTAAAATTAAATAATAATAGCAAGTAAGATCACAAGTCCACATCCCGTAC
AAGACTCGTCAAGTGTTCGCACCTTTCAGCTTCTTCTCACGAGCCATCAAAGCAGCCTCCTGTCGACGCAGATCTTCCTCAATTCCCAACAACTCCTTCA
TTTTCTGGTTGTAAGACGTCTGCAAGTTCTGGTCAGCAGCTGGCGGCGGTACGTTCGCTGCAGTGTACGCACGTAATCTCTGTTGCAGTTGTGGCACACG
TTCCAGGTCCTCGATTCTCGGTCGTCGAGAGCGTTGTCTGTGCAGCATCCATCGGATGACCTGGAAAAGTCCCTCCGAGTACTGGGACGGGATACGCGTG
AACTTGCCTGCGTTAATCTTTTTCGCTAGTGCGAGCTGGTTCGTCGCGTCGAAAGGAGGCCCAAGTGTAGCCATCTCGTACAGCAAACAACCCAGAGCCC
AAATGTCGGATCGGTCGTCGTAAGTCATCTCGTTCACCATCTCTGGACTCATGTAGTACGGAGTGCCGACGTTCGTCTGGGCAAATCGAGACTCGCTACT
GAGTTCCTTTGCGAGCCCAAAGTCACCGAGTTTCGCATTGTTCTGTGTGTGGGATAAAGACAAAAAAACCCTGTGAGAAAACAGCATATACCAAATACAA
AGAAAAAACTAAAAAACACAAGTAGCGAAATTGCCATCGTACGTTCGAGTCTAGGAAAATGTTGCCAGGCTTGATGTCACGGTGAAGAATAGGACGAATG
ACGTTGCCCTCGCGGTGACGGTGACACTCCTTCAGCGCCAGGAAAATGTGCGTGAAAATGTGCCAGATAAAGCCCTCTTCGATGTAGGACCTGCAGATAA
AATTGCCATAAAAAGTCAGGAAATCCACTCGAATAGATACAAGATGCTGTTCTTGGGATTGGCATCGAACAATGGCGTACCCTTCCCGCTTTTTCCTCTT
GATGAACTGGCCAAGGTCACCACCTTCGCAGTATTCCATGACGATGTAGATCTTGGTTGCCTGCTTGTCGATCACTCGGTCCAAGTACCGGACAATATGC
GGGTGCCTTAGTTCCCTCAGAATATTCACCTGCAACATCCTATAGCGTTAGTGCTTGCACTCTCTTGTTCCATATCTAGACCTGGTCATGCTGACGCACC
TCGCTGACGATGAGTTGCTTCTCCTTCTCACTCATGGCGCCGTAGTTGACTTCCTTCCACACCAGCATCTGCTCGCCACATTACACGTTAGTAAAAAGTC
CTGCAGTCTCCTGTTGGCGTATTCCTGGAGTCTCTGCTGCTCACCTTGCGGTCTGCCTTACGCACGATCTGCGTCACGACGCCGAACGAGCCCTTGCCGA
TGATGCGGACCTGCTCGTACGCGTCCATGTTGGATAACTAGTGTGTTGATACTGTGAGGAGGAAATAAACCGCTCTGGGCTGTAGCTGCGAGAGAGGGAG
GAGCTGTGTGTCTGGTAACGCGTGAGTCGAGATCGAGGCGACTGAAACACGGGTCGCCTCGGGGGAACTTCTCTCCTCTCCGCTGTTCTTCGTTTGTGGC
GGGGCGTTGGTGTCGTTTTGTGTAGGGAGAGAGTCAGTGGGGGGAGGGAGAGTCGTGAGGACGATTTGATAACTGATAGGATATCGGATAAGGTAGAGAC
TAATTAACACTCCGTTTTACAGTCTCCCCGAAATCGAGGCACGTAAGAGGCGGAAGAGAAAGTCGACATCGCAAGTCGTGCATTTTTCGGCGCGTCGTTG
GCGCTGCAGCTTCACGCTCTGAGCTGCAAACACAGATGTCGACTTGAAGCTGATAATCTCTTTCCGTCTTTTTGGTTGCAATCGAATGGCTACATCTTCA
GCTTTTTTTAATGCTCAGCAGCCAGTAGAGCCTCCTGGTCGAGTGCATCTTCGTCTAGCATGAGCGAGACCCTTCTCTTCTTGGCGTTTGTATGGTTCAA
GATGGACCCGTTCTGGTAGTCGACCACATTCAGCGCGATACCCACGAGACTGCCCAGCACTCCGAACGACACGAACAACAACTCCACACCTGGAATGTAT
CGGTCGTCGTGGTTGAATTCAGCCGCTACTGCCAGCGGGAACAACGCAAGGCCGATGTTCTGTATTGGTACACGCAAGAACAACGTGTTAGAATCTAGTA
CACCAGCTTAAAAGCCGCATCGGAGCAACATGGTCGCTAGAATAAAAGGGTGTTTTTAAACGGGGAATCCATGGAACGCACCTGGATGGCAGTGATCGCT
CCGTACGCTGTTCCAACGTGTTTGGCTTCCACCACGTCTGTGTAGGCAAAAGATACGATTAAATTCATGTAAGCTCTTCTAAAACTCAGCAGTGAACGTA
CATGGGACTGAAGGCCATAGCGCTGCGGCAAACACGCTGTAGGCAACACCTTGCAGCACCAACGGCACGTACAGTGATACTTGAGTCAACCCGAGCATGA
CGTGAACTACCGTCAGTGCTAGAGGAGCCAATAACGCTAAAAAGGCGCGGAGACCAATCCGATCAACCACAAAGCCTAAGAACGGGGAAATAACCGCGCT
GATAATATACGGGATGGACATTGGAGTGGCAGTCTTCTGCGCCGCATCGGTCTTCGTGGCACAGTACGTCTTGGTCAAAGGGCCAAGCTTCCACGCTTCA
TCGTCGCAATTAATTTTATCACCAAGAATCAGTGGAGGAGAAGTCGAGCAGTCCCATTGATCCAGTGGCTCTTTGATCGTACAGTTCGCAGACAACAGAG
GGAGTGGCCATCCGTACGGAGGGACGCTAGGACATCCAGAGACGATCTCTTGGCAGTCAATTTCGCCAATGTAGAGTCCCTCTCCACACCTTCGACACAG
CTCTGGAGGCTCCTTGAAGAAGTCCCGCTCCATTAGGAGACTGCTGGCAACGTTGTTGAAGGGGATAACGCAGCCGTACACGACCAAACAACTCAGCGCC
AATAGCCAAAACGCTGGACGGAAATGTTTGACATCACTCAAGTGAATACTCTCAGCAGCAGTCACTCCTTCTTTCTGGTTCTCCCTCGACATCTTCTCCG
CTCTCTTGTCGATTGGGATCACCAGTAGCACAGTGACGGCAGATCCCACACACATGATGACACCCACCCAAAGCGCAGCCGACACACTGGATGATTGAGC
GACGATTGGACTCAGCTCATTGTTGATAACGCTTCCAAGACGAGCTACACTGAGGTTAATGCCCAAGGCCAGTGCGAGCTCACTGTTCTTGAACCACGAG
GCTACGAGCGTCCCCTGAGCTACACCCAAGCTCTCACCACCGAAACCGAACATCACTCGACCAAACTTGTGCAAGAATGATGTTAAAAATTATGGAATAA
CAACAAATTGCAGCGTATAATTTGCCTTACCAGCATCAGATTGAAGCTAGATAACGAGCAGCCAGTTGCAAAGATCAATTGGCCTGCCAAGATTGCCGTC
GAGAAAGCAAATAGCATCACACGCGCACCGAATCGATCCACCAGCACACCGCCAAAGAACGGCAGCAAGATGTTGGGGATCGAATACAGTGTGTACAGCA
GGTTCTACAAGCATGCATCAACAATTATTACCGGAAAGCATGCGAGATACACTGTACGTGTCTTGAAAACAACAACTGTTGAACGTACGAAGAGAAACTC
GTAGCGGTCCTTTGGGATGTTGCTGAAGTGCTGCTGCAGCTGACTCTTTAGCGCTGCCGGGTTGTCGAAGCAGTAGTAGTTGCCGATCATCAGTACACAT
GACAGAAACAGCACCAGCCAGCGCACGCGCAGCTCGCTCTTCTCCGCCATGATAACTCTTCTCAGGGGGAAGGATGTGATATCTGAGTCTGACTCAGAT